ID: 1152925914

View in Genome Browser
Species Human (GRCh38)
Location 17:83087675-83087697
Sequence GCACTCTCCGGCCAGCGCCG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 104}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152925906_1152925914 0 Left 1152925906 17:83087652-83087674 CCCTGGGCCAGGCCGGCTCCCCA 0: 1
1: 0
2: 1
3: 33
4: 356
Right 1152925914 17:83087675-83087697 GCACTCTCCGGCCAGCGCCGCGG 0: 1
1: 0
2: 0
3: 2
4: 104
1152925907_1152925914 -1 Left 1152925907 17:83087653-83087675 CCTGGGCCAGGCCGGCTCCCCAG 0: 1
1: 2
2: 4
3: 59
4: 527
Right 1152925914 17:83087675-83087697 GCACTCTCCGGCCAGCGCCGCGG 0: 1
1: 0
2: 0
3: 2
4: 104
1152925904_1152925914 5 Left 1152925904 17:83087647-83087669 CCATCCCCTGGGCCAGGCCGGCT 0: 1
1: 1
2: 4
3: 57
4: 464
Right 1152925914 17:83087675-83087697 GCACTCTCCGGCCAGCGCCGCGG 0: 1
1: 0
2: 0
3: 2
4: 104
1152925898_1152925914 28 Left 1152925898 17:83087624-83087646 CCGGCCGTCTGGCAGCAGTGACG 0: 1
1: 0
2: 0
3: 4
4: 76
Right 1152925914 17:83087675-83087697 GCACTCTCCGGCCAGCGCCGCGG 0: 1
1: 0
2: 0
3: 2
4: 104
1152925908_1152925914 -7 Left 1152925908 17:83087659-83087681 CCAGGCCGGCTCCCCAGCACTCT 0: 1
1: 0
2: 1
3: 21
4: 298
Right 1152925914 17:83087675-83087697 GCACTCTCCGGCCAGCGCCGCGG 0: 1
1: 0
2: 0
3: 2
4: 104
1152925905_1152925914 1 Left 1152925905 17:83087651-83087673 CCCCTGGGCCAGGCCGGCTCCCC 0: 1
1: 0
2: 5
3: 55
4: 551
Right 1152925914 17:83087675-83087697 GCACTCTCCGGCCAGCGCCGCGG 0: 1
1: 0
2: 0
3: 2
4: 104
1152925899_1152925914 24 Left 1152925899 17:83087628-83087650 CCGTCTGGCAGCAGTGACGCCAT 0: 1
1: 0
2: 0
3: 7
4: 102
Right 1152925914 17:83087675-83087697 GCACTCTCCGGCCAGCGCCGCGG 0: 1
1: 0
2: 0
3: 2
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152925914 Original CRISPR GCACTCTCCGGCCAGCGCCG CGG Intronic