ID: 1152927357

View in Genome Browser
Species Human (GRCh38)
Location 17:83093384-83093406
Sequence CTGTCCCCAGGGCTGGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 599
Summary {0: 1, 1: 0, 2: 3, 3: 47, 4: 548}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152927357_1152927366 2 Left 1152927357 17:83093384-83093406 CCCTCCACCAGCCCTGGGGACAG 0: 1
1: 0
2: 3
3: 47
4: 548
Right 1152927366 17:83093409-83093431 ACGCCACCGCCCACACTTGGAGG 0: 1
1: 0
2: 2
3: 3
4: 47
1152927357_1152927370 9 Left 1152927357 17:83093384-83093406 CCCTCCACCAGCCCTGGGGACAG 0: 1
1: 0
2: 3
3: 47
4: 548
Right 1152927370 17:83093416-83093438 CGCCCACACTTGGAGGGAGCTGG 0: 1
1: 0
2: 2
3: 12
4: 136
1152927357_1152927371 10 Left 1152927357 17:83093384-83093406 CCCTCCACCAGCCCTGGGGACAG 0: 1
1: 0
2: 3
3: 47
4: 548
Right 1152927371 17:83093417-83093439 GCCCACACTTGGAGGGAGCTGGG 0: 1
1: 0
2: 4
3: 17
4: 218
1152927357_1152927367 3 Left 1152927357 17:83093384-83093406 CCCTCCACCAGCCCTGGGGACAG 0: 1
1: 0
2: 3
3: 47
4: 548
Right 1152927367 17:83093410-83093432 CGCCACCGCCCACACTTGGAGGG 0: 1
1: 0
2: 0
3: 10
4: 64
1152927357_1152927376 21 Left 1152927357 17:83093384-83093406 CCCTCCACCAGCCCTGGGGACAG 0: 1
1: 0
2: 3
3: 47
4: 548
Right 1152927376 17:83093428-83093450 GAGGGAGCTGGGGGTTGTTTTGG 0: 1
1: 0
2: 1
3: 32
4: 364
1152927357_1152927373 11 Left 1152927357 17:83093384-83093406 CCCTCCACCAGCCCTGGGGACAG 0: 1
1: 0
2: 3
3: 47
4: 548
Right 1152927373 17:83093418-83093440 CCCACACTTGGAGGGAGCTGGGG 0: 1
1: 0
2: 3
3: 32
4: 339
1152927357_1152927365 -1 Left 1152927357 17:83093384-83093406 CCCTCCACCAGCCCTGGGGACAG 0: 1
1: 0
2: 3
3: 47
4: 548
Right 1152927365 17:83093406-83093428 GGGACGCCACCGCCCACACTTGG 0: 1
1: 0
2: 0
3: 6
4: 84
1152927357_1152927375 12 Left 1152927357 17:83093384-83093406 CCCTCCACCAGCCCTGGGGACAG 0: 1
1: 0
2: 3
3: 47
4: 548
Right 1152927375 17:83093419-83093441 CCACACTTGGAGGGAGCTGGGGG 0: 1
1: 1
2: 0
3: 36
4: 352

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152927357 Original CRISPR CTGTCCCCAGGGCTGGTGGA GGG (reversed) Intronic
900109695 1:1000290-1000312 CTGTCCCCAGCGGTGTCGGAGGG - Intergenic
900151695 1:1181723-1181745 CTGTCCCCTGGGCTGCAGGCTGG + Exonic
900208318 1:1440954-1440976 CTGGGCCCAGGGCAGGTGGCTGG + Exonic
900288622 1:1914415-1914437 CTTTCCCCTGGGCTGGGGCAGGG - Intergenic
900397189 1:2457936-2457958 CTGTCCACCGGGCGGGTGGTAGG + Intronic
900416489 1:2537535-2537557 CTGCCCCCAGGCATGGTGGTGGG - Intergenic
900438534 1:2642437-2642459 CTCTCCCTGGGGCTGCTGGACGG + Intronic
900470897 1:2854446-2854468 CTGTGCCCTGCTCTGGTGGACGG + Intergenic
900659895 1:3777062-3777084 CTCACCCCAGGGCTGGGGGTGGG + Intergenic
900685437 1:3945093-3945115 CAGTCCCCAGGGGTGCTGGGTGG + Intergenic
900710423 1:4109792-4109814 CTGTCACCAGGGCGAGCGGATGG - Intergenic
901004073 1:6163278-6163300 CTTTCCCCAGTGCAGGTGGATGG - Intronic
901794624 1:11673212-11673234 CTGGCCCCAGGGGTGGGGGCAGG - Intronic
901921693 1:12541561-12541583 CTGTCCCCAGAGCTGGGGAGGGG + Intergenic
902290835 1:15433659-15433681 CTGACTCCAGGCCTGGTGCAGGG - Intergenic
902436769 1:16403142-16403164 GTGTCTCCAGGGCAGGTGGGTGG - Intronic
902437504 1:16408055-16408077 CTGTGCCCAGCCCTGGTAGAGGG + Intronic
902917259 1:19646158-19646180 CTCTCCCCAGTGCTGAAGGAAGG + Intronic
903265075 1:22153358-22153380 CTCTCTCTTGGGCTGGTGGAAGG + Intergenic
903658089 1:24960992-24961014 CTACCCTCAGGGCTGGTGCATGG - Intronic
904301066 1:29555322-29555344 CTTTCCCCAGGGCAAGTGGGGGG + Intergenic
904313001 1:29641513-29641535 CTGTCCCCAGGGTCTGTGGGTGG - Intergenic
904374032 1:30068567-30068589 CTCTCTCCAGGGTTGGTGGTAGG + Intergenic
904396520 1:30225938-30225960 ATGGTCCCAGGGCTGGAGGAAGG - Intergenic
904620614 1:31772919-31772941 GTGTGCCCAGGGCTGGCGGCGGG - Intergenic
904746878 1:32716791-32716813 CTCTCTCCAGAGCTGGGGGAGGG - Intergenic
905416799 1:37809105-37809127 CCCTCCCCAGGGCCGGTGGCTGG + Exonic
905874956 1:41426697-41426719 CTGTCCCCGGGCCTGGTGGGAGG + Intergenic
905911755 1:41659860-41659882 GTGTCCCCAGAGCTGGTGAGGGG - Intronic
906019265 1:42613166-42613188 CTGCCCCGAGGGCTGCTGGTTGG + Intronic
906281057 1:44554177-44554199 CTGCCCCCAGGAATGGAGGAAGG + Intronic
906295227 1:44645415-44645437 CTTTCACCATTGCTGGTGGATGG - Exonic
906868238 1:49446956-49446978 CTGTGCCCAGGGATGAAGGATGG - Intronic
906868297 1:49447369-49447391 CTGTACCCAGAGCTGATGCAGGG - Intronic
907954912 1:59218832-59218854 CTCTCCCCATGGCTTGTAGATGG + Intergenic
908239478 1:62176778-62176800 CTAGTCCCAGGGCTAGTGGACGG + Intergenic
910458330 1:87422053-87422075 CTTTCCCCTTGGCTTGTGGATGG + Intergenic
910994497 1:93090011-93090033 CTGTCCCCCGGGCTGGAGCGCGG + Intronic
911128446 1:94364398-94364420 CAGGCCCCAGGACTGGGGGAGGG - Intergenic
912462053 1:109841275-109841297 CTGTCCCCCAGGCTGGAGGGCGG - Intergenic
912757294 1:112334893-112334915 CTGTCACCAAGGCTGGAGTACGG - Intergenic
912971518 1:114288283-114288305 CTGTCCCTGGGGCTGGTTCAAGG - Intergenic
915002465 1:152605960-152605982 CTGTCACCTGGGATGGTTGATGG - Intergenic
917962406 1:180155219-180155241 CTGCCCACCGGGCAGGTGGAGGG - Intronic
918084946 1:181237426-181237448 CTGTCCCTAGGGCTGAGGCATGG + Intergenic
918466858 1:184829501-184829523 CTGTCACCTGGGCTGGAGTAGGG + Intronic
919767205 1:201135151-201135173 CTGTCCTCAGGGCTGGAGCTGGG + Exonic
919927160 1:202197986-202198008 CTGCCACCAGGGCTGAGGGAGGG + Intronic
920182758 1:204142725-204142747 CTGGCCCCTGGGCTGGGTGAGGG - Intronic
920366323 1:205450080-205450102 CCGTCCTCAGGGCTGGGGGAGGG - Intronic
920438194 1:205961669-205961691 CTGGGCCCAGAGCTGGGGGATGG + Intergenic
921152596 1:212414238-212414260 CTGTCCCCGCGGCTGGTGACAGG - Intronic
922561250 1:226571192-226571214 CTGTCTCCCAGGCTGGAGGACGG - Intronic
923548164 1:234939990-234940012 CTGCCGCCAGGGCTGGTGGATGG - Intergenic
924061806 1:240182951-240182973 CTGTCACCCAGGCTGGTGTATGG + Intronic
924804563 1:247352136-247352158 ATTCCCCCTGGGCTGGTGGATGG + Intergenic
1063286557 10:4694818-4694840 CTGCTCCCAGTCCTGGTGGAAGG - Intergenic
1063866064 10:10366918-10366940 CTGTCCCCATGGCCAGGGGATGG + Intergenic
1064135056 10:12743308-12743330 CTGTCACCCAGGCTGGAGGACGG - Intronic
1064423468 10:15210100-15210122 CTCTCCCCACGGAGGGTGGAAGG - Intergenic
1064541083 10:16405923-16405945 CTGTTCCCAGGGCAGGGGGAGGG + Intergenic
1065814951 10:29474914-29474936 CTGTCACCAGGGCTGCTGCCAGG + Intronic
1066097520 10:32086253-32086275 CTGTCACCCAGGCTGGAGGAGGG - Intergenic
1066194354 10:33084275-33084297 CTGTCACCTGGGCTGGAGTATGG - Intergenic
1066489965 10:35884858-35884880 CTGTCCCCAGGGCTCCTGCCTGG + Intergenic
1067437249 10:46287011-46287033 CTGTCCCCAGGGTGGGGGAAGGG + Exonic
1069498848 10:68931347-68931369 CTGTCACCCAGGCTGGTGGGTGG + Intronic
1069773448 10:70913579-70913601 CTCTCCACAGGGCAGGTGGGGGG + Intergenic
1069777029 10:70933254-70933276 CTGGGCCCAGGTATGGTGGAAGG + Intergenic
1069822363 10:71235668-71235690 CAGTCCTCAGGGCTGGAGGCTGG - Intronic
1069915103 10:71782525-71782547 CTGTCTCCAGGAGTTGTGGAGGG + Intronic
1071008339 10:80909610-80909632 TTATCCCCAGGGTTGGTGGTGGG - Intergenic
1071259365 10:83906083-83906105 CTGTCACCCAGGCTGGTGTACGG - Intergenic
1071434610 10:85635602-85635624 TTGTCCTCAGGGCTGGCTGAGGG - Intronic
1073280698 10:102351972-102351994 CTGGCCCCAGGAATGGTGAAGGG - Intronic
1073320998 10:102616224-102616246 CTGTGCTCAGGGCTGCTGCACGG + Intronic
1073479232 10:103775736-103775758 CTGGCACCAGGGCTGGATGAGGG + Intronic
1073493094 10:103867937-103867959 CTCTCTCCTGGGCTTGTGGATGG - Intergenic
1074030101 10:109678446-109678468 TTGTCCCCAGGTCAGGTGAAGGG + Intergenic
1074980675 10:118617375-118617397 CTTTCCCCTGGCCTGGAGGAAGG - Intergenic
1075495197 10:122914001-122914023 CTGTCCCCCAGGCTGGTGTGCGG + Intergenic
1075541308 10:123316791-123316813 CTGTCTTCTGGGCTGTTGGAGGG - Intergenic
1076009162 10:126973263-126973285 CTGTCGCCCGGGCTGGAGTATGG + Intronic
1076164849 10:128273377-128273399 GTGTCCCCAGGAGTGGTGGCAGG - Intergenic
1076616556 10:131759052-131759074 GAGTCTCCAGGGCTGGGGGAGGG - Intergenic
1076855581 10:133114121-133114143 CTGTTCCCAGGGGTGGAGAAGGG - Intronic
1076877605 10:133224158-133224180 GTGTCCCCAGGCCTGGCTGAGGG + Intronic
1077018083 11:405771-405793 CTTTTCCCAGGGCTGCTGGCAGG + Exonic
1077109963 11:858005-858027 CAGTTCCCAGGTCTTGTGGAGGG - Intronic
1077184662 11:1230751-1230773 CTGACCTCAGGGCTGGAGGGGGG - Intronic
1077229863 11:1453925-1453947 CTGGCCCCCGCGCTGGTGGGTGG + Intronic
1077949460 11:6940339-6940361 CTGTCACCAGGGCTGGAGTGTGG + Intronic
1078942458 11:16023126-16023148 TTCTTCCCAGGGCTGGTGGAAGG - Intronic
1079130146 11:17742492-17742514 CTGGCCCCAGAGCTGATGGGAGG - Intronic
1080124450 11:28715924-28715946 CTGTCAAGAGTGCTGGTGGACGG - Intergenic
1080896403 11:36452149-36452171 CTGTCCCCAGGAATGGTGCCTGG + Intronic
1081695324 11:45105579-45105601 CTGTCACCACGGCTGGAGGGAGG - Intronic
1081747038 11:45480690-45480712 CTGTCCCCAGGGAAGGTGGTGGG + Intergenic
1081877513 11:46419675-46419697 CTGCCCCCAGGGTTGATAGAAGG + Intronic
1082277134 11:50233870-50233892 CTGTCACCAAGGCTGGAGTACGG - Intergenic
1083593912 11:63910063-63910085 CTGACCCCAGGGCTGGGAGAGGG + Exonic
1084038838 11:66530079-66530101 CGGTCCCCAGGTCTGCGGGAAGG - Intronic
1084117901 11:67052616-67052638 TTGGGCCCAGGGCTGGAGGAGGG - Intergenic
1084289234 11:68151253-68151275 CTGTCACCCGGGCTGGAGTACGG - Intergenic
1084427641 11:69094321-69094343 CTGTCCCCAGTGCAGGTGGCTGG + Intergenic
1084591079 11:70090999-70091021 CAGCCCCTAGGGCTGTTGGAAGG + Intronic
1084945583 11:72636699-72636721 GAGTGGCCAGGGCTGGTGGAGGG - Intronic
1084967037 11:72750311-72750333 CTGTTCCCAGGGTAGGGGGAGGG - Intronic
1085386885 11:76162688-76162710 CACTCACCAGGCCTGGTGGAGGG - Intergenic
1085389275 11:76174311-76174333 GTGTGCCCAGGGCTGAAGGAGGG + Intergenic
1087730323 11:101771550-101771572 CTGTTCACAGGTCTGATGGAGGG - Intronic
1089690729 11:120185288-120185310 CACACCCCAGGGCTGGGGGAAGG + Intronic
1089705142 11:120272370-120272392 CTCTCCCCAGGGATGGTGTGTGG - Intronic
1089896190 11:121932476-121932498 CTGTCCTCAGGGCTAATGCAGGG - Intergenic
1090225658 11:125070772-125070794 CTGTCACGAGGGGTGGGGGATGG - Intronic
1090289281 11:125527899-125527921 GTGTCCCCAGGGCTGGGGCAAGG - Intergenic
1090415887 11:126540320-126540342 CTCTTCCCAGGGCTGGATGAGGG + Intronic
1090426350 11:126609308-126609330 CTTCCCCCCGGGCTGGTGGCTGG + Intronic
1090498153 11:127234623-127234645 TTATGCCCAGGGCTGGTGGCTGG + Intergenic
1091602033 12:1923640-1923662 GGGTGCCCAGGGCTGGAGGAGGG + Intergenic
1091770054 12:3145700-3145722 CTGTCCAGATGGCTGGGGGAAGG + Intronic
1091773521 12:3169246-3169268 TTGACCTCAGGGCTGGGGGAAGG + Intronic
1091917506 12:4280501-4280523 CCGCCCCCAGGGCTGCAGGAAGG - Intronic
1095946933 12:47758933-47758955 CCCTCCCCAGGACTGGCGGAGGG + Intronic
1096033496 12:48442514-48442536 CTGTGTTCAGGGCTGGTGGGGGG - Intergenic
1096412024 12:51383910-51383932 CTTTCTCCAAGGCTGGTGGAGGG - Intronic
1096577373 12:52561380-52561402 CCTTCCCCAGGGCAGGAGGATGG + Intergenic
1096714663 12:53483821-53483843 CCAGCCCCAGGGCGGGTGGAAGG - Intronic
1098885534 12:75956771-75956793 CTGTCACCAGGGCTGGAGTGCGG + Intergenic
1098981715 12:76963218-76963240 CTCTCTCTGGGGCTGGTGGAAGG + Intergenic
1101614867 12:106326351-106326373 CTGTCAACAGGGAGGGTGGATGG - Intronic
1102163420 12:110787409-110787431 CTCTCCCAAAGGCTGTTGGAGGG - Intergenic
1102556819 12:113732152-113732174 CTGTCCCCAGAGCGGAGGGAAGG + Intergenic
1102573558 12:113842276-113842298 CTGGCCCCGGGGTTGGGGGATGG + Intronic
1103530316 12:121596633-121596655 CTGTCACCCAGGCTGCTGGAGGG + Intergenic
1103738821 12:123078008-123078030 GTGTCCCCAGGATGGGTGGACGG + Intronic
1103994558 12:124820655-124820677 GTGTCCCCCAGGCTGGTGAAGGG - Intronic
1104065406 12:125301403-125301425 CTGGGCACAGGGCTGGTGCACGG - Intronic
1104381779 12:128313657-128313679 CTAGCCCCTGGGATGGTGGACGG + Intronic
1104691905 12:130832874-130832896 CTGTGGACAGGGCTGGGGGAGGG - Intronic
1104804413 12:131575896-131575918 CTGAGCCCAGGGCAGGTGGCAGG - Intergenic
1104861715 12:131927597-131927619 CTGGAGCCTGGGCTGGTGGAGGG + Intergenic
1106123278 13:26879833-26879855 CTGTTCTTAGTGCTGGTGGAAGG - Intergenic
1107805373 13:44148850-44148872 CAGTACCCAGAGCTGGAGGATGG + Intronic
1110928990 13:81192607-81192629 CAGTCCCCAGGGTTGGAGGTAGG + Intergenic
1112435958 13:99391405-99391427 GTCTCCCCAGGGCTGGAGAAGGG - Intergenic
1112634710 13:101202625-101202647 CTCTCCACAGGGCAGCTGGATGG - Intronic
1112896538 13:104306253-104306275 CTGTCACCCAGGCTGGAGGAGGG - Intergenic
1113536019 13:111066860-111066882 CCTTCCCCAGAGCTCGTGGAAGG - Intergenic
1113666137 13:112143196-112143218 CTGGCCTCAGGGCTGGTACATGG + Intergenic
1113807157 13:113116608-113116630 CAGGGCCCAGGGGTGGTGGAAGG - Intronic
1114487591 14:23072160-23072182 CTTTTCCCAGGGATGGTGGAGGG + Intronic
1115447718 14:33510443-33510465 CAGTTCCCAGGGTGGGTGGAGGG + Intronic
1115746383 14:36442099-36442121 TTGCCTCCAGGGCTGGGGGAGGG + Intergenic
1115748210 14:36459978-36460000 CTCTCCCCATGGCTTGTTGAAGG - Intergenic
1117135434 14:52730448-52730470 CTGGCCCGCGGGCTGGTGGGTGG - Exonic
1117401093 14:55358928-55358950 TGGTTCCCAGGTCTGGTGGAAGG + Intronic
1119418533 14:74492874-74492896 CTGTATCCAGCTCTGGTGGAGGG - Intronic
1120752461 14:88210583-88210605 CTGTGCGCAGAGCTGGTGGGAGG - Intronic
1121326667 14:93024183-93024205 CTGTTGCCAGGCCTGGAGGAAGG + Intronic
1122028071 14:98892152-98892174 CTGTCTCCCTGGCTGGTAGAGGG - Intergenic
1122153498 14:99737217-99737239 CTGTCTCCAAGGCTGCAGGAAGG - Intergenic
1122278920 14:100609974-100609996 CCTGCCCCAGGGCTGGGGGAGGG + Intergenic
1122297951 14:100716009-100716031 ATGTCCCCAGGGCAAGTGGGAGG - Intergenic
1122329231 14:100901783-100901805 GAGTGCCCAGGGCTGGTGGGGGG - Intergenic
1122389202 14:101368775-101368797 CTGTCCTAAGGGCTGGTGTGGGG + Intergenic
1122403120 14:101479164-101479186 CTGTACCCAGACCTGGGGGATGG - Intergenic
1122931401 14:104934241-104934263 CAGTGCCCAGGGTTGGTGGATGG + Exonic
1122993727 14:105251244-105251266 CTGTCCCCTGGGTTGCTGGCTGG + Intronic
1123028119 14:105438193-105438215 CTGTGGGCAGGGCTGGTGGCTGG + Intronic
1123028460 14:105439548-105439570 CTGTCCTCAGGGGTGGTGGGTGG + Intronic
1123163981 14:106308342-106308364 CTGTCACCAAGGCTGGTGTGTGG + Intergenic
1123449469 15:20350940-20350962 GGGTCCCCAGGGCTGGTGGAGGG - Intergenic
1124507991 15:30295376-30295398 CTTCCCCCAGGGCTGGCGGCGGG - Intergenic
1124628942 15:31326511-31326533 GTGTCCCCTGGGCCGGTGGGAGG - Intergenic
1124735564 15:32243281-32243303 CTTCCCCCAGGGCTGGCGGCGGG + Intergenic
1124890172 15:33725378-33725400 CTGTCCCCAGGTGGGCTGGATGG - Intronic
1125727079 15:41873653-41873675 ATGTCTCCAGGGCTGACGGAGGG - Intronic
1126803930 15:52326533-52326555 CGCTCCCCAGGGCTGAGGGAGGG + Intronic
1126876501 15:53047444-53047466 CAGTTGCCAGGGCTGGTGGAGGG - Intergenic
1126943629 15:53792821-53792843 CTGTCACCTGGGCTGGAGGCCGG - Intergenic
1127623052 15:60752762-60752784 CTGGTCCCAGGCCTGGTGCAGGG + Intronic
1127758324 15:62113950-62113972 CTGCCCTGAGGGCAGGTGGAGGG - Intergenic
1128155091 15:65386919-65386941 CTGCTCCCAGGGCTGTTGCATGG + Intronic
1128323149 15:66706399-66706421 CTGTCCCCAGGGTGGCTGAATGG - Intronic
1128688667 15:69706675-69706697 CTGTCCCTAGGGCAGTTGGCTGG + Intergenic
1128771639 15:70287055-70287077 CTGTCACCCAGGCTGGTGGAGGG + Intergenic
1129238244 15:74236534-74236556 CAGGCCCCAGGGCTGGTGTGTGG + Exonic
1129604457 15:77018056-77018078 CTGTTCCCAGAGATGGTGGGAGG + Intronic
1129616778 15:77105048-77105070 CTTTGCCCAGGGTTGGGGGATGG - Exonic
1130960416 15:88655215-88655237 CTGGCCCCAGGGCTGAAGGCAGG + Intronic
1131559140 15:93424347-93424369 CTGGCCCAGGGGGTGGTGGAGGG - Intergenic
1131873900 15:96784782-96784804 CTGTCCCCAGAGTGGCTGGATGG + Intronic
1132238330 15:100238413-100238435 GTGTCCCCAGGGCTGGAGCCGGG + Intronic
1132379136 15:101353993-101354015 CTCTGCCCAGGGATGGTGGGAGG - Intronic
1132547173 16:538666-538688 CTGTCCCCAAGGCTGTGGGGAGG + Intronic
1132571326 16:645666-645688 CCGACCCCAGGGCAGATGGAGGG + Intronic
1132723583 16:1328799-1328821 CTGTCGCCCGGGCTGGTGTGTGG + Intergenic
1132866240 16:2094001-2094023 GCTTCCCCAGGACTGGTGGAGGG - Exonic
1133022344 16:2972326-2972348 CTGGCCACAGGCCTGGTGGGAGG - Exonic
1134609068 16:15593400-15593422 CTGTCCCCATTGCTGGGGGGGGG - Intronic
1134913915 16:18053220-18053242 CTGTCTCCTGGGCTTGTAGATGG + Intergenic
1136023803 16:27456971-27456993 ATGTCCACAGGGCTGGAGGCTGG - Intergenic
1136269712 16:29141513-29141535 CGGTCCCGAGGGCGGGTGGCTGG - Intergenic
1136385953 16:29926106-29926128 CTGGCCCAAGGGCTGGGGGCCGG - Exonic
1136395115 16:29988250-29988272 CTGGGGCCAGGGGTGGTGGAGGG + Exonic
1136516639 16:30772524-30772546 CTGACCCCAGGGCCAGGGGAAGG - Intronic
1137490529 16:48928565-48928587 CTCTCCCCTTGGCTTGTGGATGG - Intergenic
1137745931 16:50819940-50819962 CTCTCTCCTGGGCTTGTGGATGG + Intergenic
1138110565 16:54320534-54320556 CTGTCCCCAGAGAAGATGGAAGG + Intergenic
1138496291 16:57411290-57411312 CTGTGCCCAGGGCTGCAGGGCGG - Intronic
1139421805 16:66853673-66853695 CTGTCCCCAGGGCAGCTGAAGGG - Exonic
1139602553 16:67995335-67995357 CTGTGCCCAGCCCTGCTGGAGGG + Intronic
1140336352 16:74108518-74108540 CTGTCCCCCAGGCTGGAGAACGG - Intergenic
1140910601 16:79448460-79448482 CTGTCACCTGGGCTGGAGTACGG + Intergenic
1141046111 16:80717449-80717471 CTGCCACCAGGGAAGGTGGATGG + Intronic
1141464591 16:84197338-84197360 CTGTTCACAGGGCTGGAGGCAGG + Intergenic
1141564485 16:84892125-84892147 CTGCCCCCTGGGGTGGTGGCAGG + Intronic
1141953690 16:87355796-87355818 TTGTCCCCGAGGCAGGTGGAGGG - Intronic
1142038607 16:87878212-87878234 GTGCTCCCAGGGCTGGCGGATGG + Intergenic
1142073336 16:88103443-88103465 CGGTCCCGAGGGCGGGTGGCTGG - Intronic
1142159294 16:88548328-88548350 CAGACCACAGGGCTGGTGGGTGG - Intergenic
1142228358 16:88888317-88888339 CTGTGGCCTGGGCTGGGGGAGGG - Intronic
1142266885 16:89068047-89068069 CTCTCCCCAGGGCTGGAGGCTGG + Intergenic
1142779079 17:2166492-2166514 CTGTCCCTCGGGCTGGAGTATGG + Intronic
1143266716 17:5643439-5643461 CTGCTCCCAGGGCTTGTGAAAGG - Intergenic
1143409921 17:6702680-6702702 CTGACCCCAGGGGAGGTGGTGGG + Intronic
1143490402 17:7282419-7282441 TTGGCCCCATGGTTGGTGGAGGG + Intronic
1145005414 17:19334620-19334642 GTGTCCCTAGGGCTGGGGGGTGG - Exonic
1145239399 17:21231264-21231286 CTGTCTCCCAGGCTGGAGGATGG - Intergenic
1145779052 17:27550074-27550096 CTGTCACCCGGGCTGGAGTACGG + Intronic
1147250780 17:39151521-39151543 CGGTCCCCGGGGCTGGCGGAGGG + Exonic
1147319642 17:39637975-39637997 CTGTCCCAATGGCCGCTGGATGG - Intronic
1147341704 17:39756323-39756345 CTGGCCCAAGGGATGGTGGAGGG - Intergenic
1148463260 17:47850159-47850181 CTGCCCCAGGGGCTGGAGGATGG + Intronic
1148749125 17:49934704-49934726 CTGTGCCCAAGGCTGGGGGTGGG + Intergenic
1148971818 17:51490452-51490474 CTGTCATCAGGGTTGATGGAGGG - Intergenic
1149429771 17:56588463-56588485 CTGTCTCCAGGGCTGGAGAGAGG + Intergenic
1150132616 17:62677438-62677460 CTGTCCCCAGGGCTGGGCCTCGG + Exonic
1150229905 17:63544146-63544168 GTGTCCCCAGGGCAGGTAGGGGG + Intronic
1151953702 17:77370000-77370022 CTGTCCCAAGGGAAGGGGGATGG - Intronic
1152243708 17:79174109-79174131 CTCTCCCCAGGCCTGGTGGTGGG + Intronic
1152262463 17:79274545-79274567 CTCTGCCCAGGGCAGGTGGGAGG - Intronic
1152581793 17:81168599-81168621 CTATCCCCCGGCCTGGGGGAAGG + Intergenic
1152598844 17:81251419-81251441 ATCACCCCAGGGCTGGGGGAGGG + Intronic
1152638608 17:81440275-81440297 GAGTCCCCTGTGCTGGTGGAGGG - Intronic
1152687499 17:81701814-81701836 CTTTCCCCAGGGCTGGGCCATGG + Exonic
1152791521 17:82282830-82282852 CGGGCCCCAGGGCTGAGGGAGGG - Intergenic
1152927357 17:83093384-83093406 CTGTCCCCAGGGCTGGTGGAGGG - Intronic
1152987603 18:334707-334729 CTGTCCCCCTGGCTGGAGGGAGG + Intronic
1153837009 18:8972342-8972364 CTGTCCTCAGGGCTGGAGGCTGG + Intergenic
1153981532 18:10314756-10314778 CTGTCGCCAGGACTGGAGGAAGG + Intergenic
1154170524 18:12047493-12047515 CGTTCCCCAAGGCTGGGGGATGG - Intergenic
1154170554 18:12047590-12047612 CATTCCCCAAGGCTGGGGGATGG - Intergenic
1154316750 18:13310316-13310338 CTGTCACCCAGGCTGGAGGAGGG - Intronic
1154411776 18:14145642-14145664 CTGCCCCCAGGGCAGGGGTAAGG + Intergenic
1155126378 18:22880582-22880604 CTATCCCCAGGGGTGTTAGAGGG - Intronic
1155400882 18:25437816-25437838 CTGTATCCAGGGCTGGAGAATGG - Intergenic
1155707712 18:28837430-28837452 CTATCCCCAGTGTTGGAGGAGGG - Intergenic
1155907486 18:31469250-31469272 CTGGTCCCAGGGCTTGTGGTTGG - Exonic
1156372481 18:36483952-36483974 GTGTCCCCACAGCTGGTGAATGG - Intronic
1157469673 18:47979587-47979609 CTGTCTCAAGGGCTGGCAGAGGG - Intergenic
1157498843 18:48175684-48175706 CTGATGCCAGGGCTGGTGCAGGG + Intronic
1158405192 18:57154197-57154219 CTGTCCCCATTGTTGGTGCAGGG + Intergenic
1158435148 18:57430270-57430292 CGGTCCCCAGGACTGGGGGCTGG - Intergenic
1160486259 18:79295818-79295840 GTGTCCTCAGGGCTGGGAGAGGG - Intronic
1160552677 18:79705080-79705102 CTGCCACCAGGGCTGTTGGGTGG + Intronic
1160665765 19:327444-327466 CTGTCTCCAGCTCTGGTGGCTGG - Intronic
1160876833 19:1300358-1300380 CTGTGCCCTGGCCTGGGGGAGGG + Intergenic
1161091041 19:2360201-2360223 CTGGGCCCGGGGCTGGAGGAAGG - Intergenic
1161199762 19:3008043-3008065 CTGTCCCCCAGGCTGGAGTACGG - Intronic
1161280143 19:3441573-3441595 CTGGCCCCTGGGCTGGAGCAGGG + Intronic
1162500834 19:11052734-11052756 CTGTCTGCAGGGCTGGGGGAGGG - Intronic
1162827569 19:13263047-13263069 CTGGTCCCAGGGTTGGTTGAGGG + Intronic
1162930610 19:13955761-13955783 CTGTCCTCAGGCAAGGTGGAGGG + Intronic
1162932067 19:13962358-13962380 CTGCCCCCTGGGGTGGTGGGAGG + Exonic
1163018325 19:14470153-14470175 CTGTCCCCAGGGATGGGCTATGG + Exonic
1163045518 19:14638648-14638670 CAGTCCCAAGGGCAGGTTGAAGG - Intronic
1163287562 19:16358002-16358024 CTGTCCTCAAGGCTGGTGGAGGG - Intronic
1163456997 19:17412814-17412836 CTGTCTCAGGGTCTGGTGGAGGG + Intronic
1163546989 19:17946572-17946594 CTGTCCCCAGGGCTCAGTGAGGG - Intergenic
1163591363 19:18195923-18195945 CTGGCCCAAGGGCAGGTAGAGGG + Intronic
1163692723 19:18746052-18746074 CTGTCCCCAGAGCTGGAAGCAGG - Intronic
1163734789 19:18973047-18973069 CTCACCCCAGTGCTGGTGGGAGG - Intergenic
1164840073 19:31386673-31386695 CTGGCCACTTGGCTGGTGGATGG - Intergenic
1164890720 19:31820998-31821020 CTCTCTCCATGGCTTGTGGATGG + Intergenic
1165348342 19:35262757-35262779 CTGTCCTGGGGGCAGGTGGATGG - Intronic
1165386788 19:35514530-35514552 CTGGCCCCTGGCCTGGGGGATGG - Intergenic
1166688590 19:44809994-44810016 CTGTCCCCAGGGAGGGGTGACGG - Intronic
1166807993 19:45498454-45498476 CTGATCCCAGGGCTGAAGGATGG + Exonic
1166844658 19:45719348-45719370 GAGTCCCTAGGGCTGGGGGAGGG + Intronic
1167399405 19:49255071-49255093 TTGTCCTCAGGGCAGGTGGAAGG + Intergenic
1167801212 19:51743513-51743535 CTGACCCCAGAGCTTCTGGAGGG - Intergenic
1168322468 19:55518296-55518318 CTGTCCCCAAGGAGGTTGGAAGG - Exonic
1168584855 19:57583996-57584018 TGGTCCCCAGGGCTGAGGGAAGG - Intronic
924977506 2:191678-191700 CTGTGCACAGTGCTGGTGGGAGG - Intergenic
925041898 2:738706-738728 CTGGCCTCAGGGCTGGGGCAGGG + Intergenic
925266503 2:2570072-2570094 CTGTCCCCAGGCCTGCCGGATGG - Intergenic
925673587 2:6337322-6337344 CTGGCCCCAGGGTTGCTGCAAGG + Intergenic
926119573 2:10234804-10234826 CCTTCCCCAGTGCTGGAGGATGG + Intergenic
927441209 2:23119341-23119363 CTGTCCACACAGATGGTGGAGGG + Intergenic
927478922 2:23435049-23435071 ATGTCCTCAGGGCTGGTGTGAGG + Intronic
927709031 2:25313950-25313972 GTGTCCCCGGGGCCGCTGGAGGG + Exonic
929542625 2:42834113-42834135 CTGTGCCCAGTGCCTGTGGATGG + Intergenic
929791047 2:45023446-45023468 GTGAGCTCAGGGCTGGTGGAGGG - Intergenic
930062070 2:47298374-47298396 CAGTCCCAAGGGCTGCTGGTTGG - Intergenic
932214223 2:69956015-69956037 CTGATCCCAGGGCTGGTACAGGG + Intergenic
932736895 2:74260599-74260621 CTGTCTAAAGGGCTGGTGGATGG - Intronic
933537343 2:83592670-83592692 CAATCCCCAGTGTTGGTGGAGGG + Intergenic
933702482 2:85265382-85265404 CTGGCACCAGGGCTGCTGGGAGG - Intronic
934573877 2:95388549-95388571 CTGTCCTCAGGGCAGGGTGAGGG - Intergenic
935010365 2:99129550-99129572 TTGCCCCCAAAGCTGGTGGAGGG - Intronic
935173921 2:100631434-100631456 CTGTCACCCAGGCTGGAGGAGGG + Intergenic
935582904 2:104774264-104774286 CTGCCCTCAGTGCTGGTGTAGGG + Intergenic
935593638 2:104863401-104863423 CTTTCTGCAGGGCTTGTGGAAGG + Intergenic
935753000 2:106255487-106255509 ATGTGCCCAGTGCTGGTGGTAGG - Intergenic
935913420 2:107923020-107923042 ATGTGCCCAGTGCTGGTGGTAGG - Intergenic
937054217 2:118918027-118918049 CTGTGGCCAGGGGTGGTAGAAGG - Intergenic
937842402 2:126536823-126536845 CTCTCCCCAGGGCTGCTTAATGG + Intergenic
937977513 2:127590651-127590673 CTGTCTGCAGGGCTGGTGAAAGG - Intronic
938145974 2:128835227-128835249 TTGTCCCAAGGGCCTGTGGAGGG - Intergenic
938227511 2:129628490-129628512 CAATCCCCAGGGCTGGAGGCAGG + Intergenic
942110144 2:172674155-172674177 CTCCTCCCAGGTCTGGTGGAAGG - Intergenic
942201349 2:173574559-173574581 CTGGACCCAGCACTGGTGGAGGG - Intergenic
942579966 2:177407642-177407664 CAGTCCCCGGGGCTGGAGGTAGG - Intronic
944831716 2:203539646-203539668 CTCTCCCCATGATTGGTGGAAGG - Intergenic
946190668 2:218006190-218006212 CTGGCCCTGGGGCTGGAGGAGGG + Intergenic
946196167 2:218034030-218034052 CTGTCGCAAGGGCTGGGGGCGGG - Intergenic
946638960 2:221762708-221762730 CTGTCCCAGGGGCTGATGAAAGG + Intergenic
946764160 2:223024544-223024566 CTGTCCCCTGGACTTCTGGAAGG + Intergenic
947114903 2:226759090-226759112 CTGTGTCCGGGGCTGGTGCAAGG + Intronic
947499576 2:230662137-230662159 CTGTCACCTGGGCTGGAGTACGG + Intergenic
947637576 2:231687853-231687875 CTGTCCCCTGGGCGGGAGGTGGG + Intergenic
947792807 2:232877426-232877448 CAGTCCCCAGGGCCTTTGGAGGG + Intronic
947839360 2:233197877-233197899 CTGGCCCCAGGCCGGGAGGAGGG - Intronic
947935041 2:233997429-233997451 CAGTCCCCACAGCTGGTGAATGG - Intronic
948592392 2:239059823-239059845 CTGTCCTGCAGGCTGGTGGATGG - Intronic
948603668 2:239121480-239121502 CTGTTCCAAGGGCTCTTGGATGG + Intronic
948768738 2:240236559-240236581 CTGTCCCCAGGGATCTGGGATGG - Intergenic
948781587 2:240324855-240324877 CTGTCCCATGTGCCGGTGGAGGG - Intergenic
948807816 2:240460525-240460547 ATGTCCCCAGGCCAGGAGGATGG - Intronic
949052067 2:241902785-241902807 CTGGCCCCTGGGCTCGGGGACGG - Intergenic
1169033377 20:2430643-2430665 CACTCCCCAGAGCTGGGGGAGGG + Intronic
1169292895 20:4367888-4367910 CTGTGCCCTGTGCTGCTGGAGGG + Intergenic
1172040981 20:32045725-32045747 CTGTGCCCAGCCCTGTTGGAGGG - Intergenic
1172292982 20:33789436-33789458 TTGTGCCCAGGGCTAGTGGAGGG + Intronic
1172485114 20:35293172-35293194 CTGACCCCAGGGGTGGTGAGAGG + Intergenic
1173900728 20:46586784-46586806 CTGACCCCTGGTCTGGGGGATGG - Intronic
1173955176 20:47026759-47026781 CTATCCCCAGCGTTGGTGGGGGG - Intronic
1174419563 20:50390843-50390865 CTGCCTCCAGGGTAGGTGGACGG - Intergenic
1175817916 20:61893227-61893249 GTGACCACAGGGATGGTGGATGG + Intronic
1175828852 20:61951157-61951179 GGGTGCCCAGGGCTGGGGGAGGG - Intergenic
1175917837 20:62435269-62435291 GTGTCGCCAGGGCTGAGGGAGGG - Intergenic
1176249784 20:64114997-64115019 CTCTGTCCAGGGCTTGTGGATGG + Intergenic
1176292821 21:5055314-5055336 GGGACCCCAGGGCAGGTGGATGG - Intergenic
1176861215 21:14012512-14012534 CTGTCACCAAGGTTGGTGGGTGG + Intergenic
1178883084 21:36464033-36464055 CAGTCCCCAGTGTTGGAGGAAGG + Intronic
1179242097 21:39601706-39601728 CTGTCAGCACGGCTGGTGGGAGG + Intronic
1179464568 21:41563026-41563048 CTGGTCCCAAGGCTGTTGGATGG - Intergenic
1179534380 21:42041945-42041967 CTGTTCCCAGGGCAGGCTGAAGG + Intergenic
1179681439 21:43024103-43024125 CTGAACCCAGGGCTGGTGACAGG - Intronic
1179809230 21:43859605-43859627 CTGACCCCTGGGATGGGGGATGG + Intergenic
1179827400 21:43973851-43973873 CTGTCCCCAGGGCTGGCCCCTGG + Intronic
1179864439 21:44208336-44208358 GGGACCCCAGGGCAGGTGGATGG + Intergenic
1179941334 21:44640370-44640392 GTGTGACCAAGGCTGGTGGAGGG + Intronic
1180074161 21:45454352-45454374 CTGACCCCAGCCCTGGGGGAGGG + Intronic
1180081882 21:45490876-45490898 GTGTCCCTGGGGCGGGTGGATGG + Intronic
1180217714 21:46336409-46336431 CTGTCCCCTGGGCTGGAGTATGG + Intronic
1181304072 22:21904534-21904556 CGGCTCCCATGGCTGGTGGATGG + Intergenic
1182292615 22:29293054-29293076 CTGTCCCTAGGGGTGGAGGAGGG - Intronic
1182560059 22:31152682-31152704 CTGTCACCCAGGCTGGAGGAGGG - Intergenic
1182572188 22:31247892-31247914 CTGTCCCCAGGACAGGCAGAGGG + Intronic
1182680292 22:32074200-32074222 TTGTCCTCAGAGCTGGTGCAGGG + Intronic
1183239812 22:36649326-36649348 CTGTCACCCGGGCTGGAGTACGG + Intronic
1183333549 22:37234167-37234189 CTGCCCCCACAGCTGGCGGAAGG + Intronic
1183477996 22:38046496-38046518 TTGTGCCCAGGGCTGACGGATGG - Intergenic
1183628741 22:39020701-39020723 CTGTCCCCATGGCCGCTGGGTGG + Intronic
1183632218 22:39040460-39040482 CTGTCCCCATGGCCGCTGGGTGG + Intergenic
1183638040 22:39076861-39076883 CTGTCCCCATGGCCGCTGGGTGG + Intronic
1183703188 22:39461355-39461377 CTCACCCCAGGGCTGGTGCAGGG - Intronic
1184238483 22:43199313-43199335 CTGTCCCCTGGGCTTGTCCACGG - Exonic
1184427753 22:44423207-44423229 CGTTCCCCAGGCCTGGTGCAGGG + Intergenic
1184599096 22:45532185-45532207 CTGTCCAGGGGCCTGGTGGAGGG + Intronic
1184710770 22:46248113-46248135 CTGTGCCCAGTGCTGGTTGGTGG - Intronic
1184748954 22:46473296-46473318 AAGTCCCCAGTGATGGTGGATGG + Intronic
1184783028 22:46658566-46658588 CTGGCCCCAGGCCTGGGGGCTGG - Intronic
1185129963 22:49033281-49033303 CTGTCTCCAGGGCTGGAGCCAGG - Intergenic
949134702 3:549906-549928 CTCTCTCCTGGGCTGGTAGATGG - Intergenic
949536100 3:4997445-4997467 CTGTCCCCCAGGCTGGAGGGCGG + Intergenic
949927915 3:9056833-9056855 CTGGGCCGAGGGCTGGAGGAGGG + Intronic
950407216 3:12812258-12812280 CTGTCCCCCAGGCTGGAGTACGG + Intronic
950460934 3:13121884-13121906 CTGCCCCCTGGGCTCGGGGACGG + Intergenic
950469805 3:13177566-13177588 CTGTCCACAGGGATGGGGAATGG - Intergenic
950614918 3:14150713-14150735 CTGTCCTCAGGGCTGGGCAATGG - Intronic
950714372 3:14837258-14837280 CTGTCTCCATGGCTGGAGAAGGG + Intronic
952242951 3:31552712-31552734 CTGTCCAAAGGACTCGTGGATGG - Intronic
952642623 3:35615225-35615247 CTGTCCCCCAGGCTGGAGGCTGG - Intergenic
953407065 3:42664771-42664793 CAGGCCCCAGAGCTGGTGGAGGG + Exonic
954110037 3:48428813-48428835 CTGACCCCCGGGCGGGTGGGGGG - Intronic
954249896 3:49359096-49359118 CTCTCTCCAGGGCTGGGGGTAGG - Intergenic
954329789 3:49883685-49883707 CAATCCCCAGTGCTGGTGGTGGG + Intergenic
955887821 3:63619280-63619302 CTGTCCCCAGGAATGGGGGAGGG - Intergenic
955901446 3:63760040-63760062 CTGTCCCCAAGGCTGGAGTGCGG + Intergenic
957592978 3:82224945-82224967 CTTTCCCCAGGGCTGCAGTAAGG - Intergenic
957667626 3:83254054-83254076 CTGTCTCCCAGGCTGGAGGAGGG - Intergenic
957888012 3:86315973-86315995 TTGTCCCCTGGACCGGTGGAAGG - Intergenic
958580048 3:96007103-96007125 CTGGCTCCAGTGCTGGTGGCTGG - Intergenic
960114314 3:113878349-113878371 TTGATCCCAGGGCTGGGGGAGGG - Intronic
960797916 3:121507888-121507910 CTGTCACCAAGGCTGGAGCATGG + Intronic
961058646 3:123810232-123810254 CTGTCCTGAGGTCTGGGGGAGGG - Intronic
961450235 3:126999353-126999375 CGGGCCCCAGGGCTGGGAGAAGG - Intronic
961791606 3:129380605-129380627 CTGTCCCCAGGGCAGGGAGCAGG + Intergenic
962918253 3:139928141-139928163 CTCTCTCCTGGGCTGGTAGATGG + Intergenic
963107754 3:141660752-141660774 CTGTCCCGAGGGGATGTGGAGGG - Intergenic
964163162 3:153670444-153670466 CAGTCCCTAGGGTTGATGGACGG - Intergenic
965520626 3:169665637-169665659 CTGTCCCCTGGCCTAGGGGATGG - Intergenic
966766967 3:183472247-183472269 CAATCCCCAGGGCTGGAGGTGGG + Intergenic
967065674 3:185913017-185913039 CTGTCCCCCAGGCTGGAGTACGG - Intergenic
968337843 3:197928979-197929001 CTGGCCACAGGGCTGGGGAAGGG - Intronic
968833624 4:2947018-2947040 TGGCCCCCAGGGCTGGTGGCTGG - Intronic
969276707 4:6140594-6140616 CTGTCCCCACTGCTCCTGGAGGG + Intronic
969277192 4:6143925-6143947 CAGTCTCCAGGGCTGGAGCAGGG + Intronic
969521422 4:7679983-7680005 CTGTCCTCAGGGCAGGTAGAAGG - Intronic
969684864 4:8665709-8665731 CTGTCCCCAGGGAGGGAGGGAGG + Intergenic
969697846 4:8745239-8745261 CGGTGCCCAGGGATGCTGGAAGG - Intergenic
971063051 4:22994024-22994046 CTGTCCCCTAGGCTTGAGGAGGG - Intergenic
971302213 4:25451035-25451057 CTGTCCCCAGGTGGGGAGGATGG - Intergenic
972310511 4:37877971-37877993 CTGGCCCCAGGGCTGCTAAAAGG - Intergenic
973730382 4:53816921-53816943 GTGCCTCCCGGGCTGGTGGAAGG + Intronic
977332315 4:95652614-95652636 CTGTCACCCGGGCTGGAGTATGG - Intergenic
977954664 4:103012866-103012888 CTGTCCCCAGGCCTCTTGTAAGG + Intronic
979037990 4:115749933-115749955 ATGTCCCCAGGGTTGGAGAAAGG - Intergenic
981323354 4:143418036-143418058 CTTTCCCCAGGGCTGCTGACTGG - Intronic
982116717 4:152104318-152104340 CTCTCTCCTGGGCTTGTGGATGG - Intergenic
983536514 4:168863005-168863027 CTGGCCCCAGCTCTGGTGAAGGG - Intronic
983648154 4:170012569-170012591 CTGTACCCCTGGCTGATGGAGGG + Intronic
984824284 4:183910506-183910528 CCATCCCCAGGGCTGGGGGAGGG - Intronic
984931625 4:184852810-184852832 CTGTGCCCAGGGCTGCTGTGGGG - Intergenic
984944229 4:184958664-184958686 CTCTCCCCAGGGATGGTATAAGG + Intergenic
985482357 5:122454-122476 CTGTCTCCTGGGCTGGAGTACGG + Intergenic
985690323 5:1306200-1306222 CTGTCACCAAGGCTGGTGTGTGG + Intergenic
985800205 5:2000952-2000974 CTGACCCCAGGACAGATGGAGGG + Intergenic
986418843 5:7556616-7556638 CTGTCCCCAGGGCTGCAGACTGG + Intronic
987077540 5:14398096-14398118 CTGTTCCTGGGGCTGGGGGATGG + Intronic
988395313 5:30690623-30690645 CTTTCACTGGGGCTGGTGGAGGG - Intergenic
988498973 5:31768268-31768290 CTGTCCCTTGGGCTGATGGCTGG - Intronic
988594810 5:32581748-32581770 CCTTCCCCAGGGCTGGTGTGGGG + Intronic
989190490 5:38665679-38665701 CTTTCCCCAGGGCTGGATGCTGG + Intergenic
990571157 5:57080101-57080123 CTGTCCCCCAGGCTGGTGTGTGG - Intergenic
990848686 5:60175869-60175891 CTATCCCCAGGGGTGGGGTATGG - Intronic
991181440 5:63755928-63755950 CAGTCCCCAGTGTTGGGGGAGGG - Intergenic
993854195 5:93052502-93052524 CCGTCCACTGGGGTGGTGGATGG + Intergenic
994028581 5:95114388-95114410 CTGTCCCAAGGGCAGGTCGAAGG - Intronic
995840413 5:116438517-116438539 CTGCCCCAAGGGCAGGAGGAAGG + Intergenic
997370451 5:133356485-133356507 CTCTCCCCAGGGGAGGTGGCTGG - Intronic
997737923 5:136228162-136228184 TTGTACCCAGAGCTGGAGGAGGG + Intronic
998042724 5:138963126-138963148 CTATCCCCATGTCTGGTGGCTGG + Intronic
998572560 5:143276119-143276141 CTGTACCCTGGGGTGGTTGATGG - Intergenic
998735783 5:145139068-145139090 CTGTCACCCGGGCTGGAGTACGG + Intergenic
999128488 5:149264659-149264681 CTGTCTCCATGGCTTGTGGATGG - Intergenic
1000321027 5:160134350-160134372 CTGTCCCCTGGGCTGGAGTGAGG - Intergenic
1001063734 5:168518118-168518140 CTGTCCCTTGGGCTGGAGTACGG + Intronic
1001093727 5:168760553-168760575 CCTACCCCAGGGCTGGTGGGTGG - Intronic
1001318860 5:170663873-170663895 GTGTACACAGGGCTGGAGGAGGG - Intronic
1001554370 5:172626070-172626092 CTGTCCCCAGGCTGGGTGGCAGG + Intergenic
1002322304 5:178383148-178383170 CTGCACCCAGAGCTGGAGGAGGG - Intronic
1003024541 6:2542533-2542555 CTCTCTCCTGGGCTGGTGGAGGG - Intergenic
1003245236 6:4377284-4377306 CTGCACCCATGGCTGGTGGGAGG - Intergenic
1003276902 6:4661131-4661153 TTGTCCCCAGCGCTGCTGGAAGG - Intergenic
1003317860 6:5027850-5027872 AAGTGCCCCGGGCTGGTGGAGGG + Intergenic
1004061728 6:12204449-12204471 CTGTGCCCAAGCCTGGTGCATGG + Intergenic
1004367172 6:15022112-15022134 CCTTCCCCAGGCCTGGTGGATGG - Intergenic
1005209417 6:23443367-23443389 GTCTCCTCAGGGCTGGGGGAAGG - Intergenic
1005682065 6:28217620-28217642 CCGGCCCCAGGGCAGGTAGACGG + Intergenic
1006664573 6:35683198-35683220 CTGTCCCCCAGGCTGGAGTATGG + Intronic
1007228902 6:40334514-40334536 GACTCCCCAGGGGTGGTGGAAGG - Intergenic
1007697827 6:43744794-43744816 CTGTCCCCAGAGCTGGGAGGGGG - Intergenic
1011827918 6:91332278-91332300 TTGTGCCCAGGGGTGGTGAAAGG - Intergenic
1012457085 6:99419114-99419136 CTGGCACCCAGGCTGGTGGAGGG - Intronic
1015592119 6:134832185-134832207 CTGTCGCCCAGGCTGGAGGACGG - Intergenic
1015638695 6:135306733-135306755 CAATCCCCAGGCCTGGTGGGGGG - Intronic
1016474306 6:144409728-144409750 CTCCCCTCATGGCTGGTGGATGG - Intronic
1018663690 6:166113835-166113857 CTGGCCCCAGGGCAGGCAGAAGG + Intergenic
1018910478 6:168098557-168098579 CGGTCACCAAGGCTGGTGGGGGG - Intergenic
1019155844 6:170038384-170038406 CTGCCCTCAGGGCTGCTGGGGGG + Intergenic
1019177512 6:170167732-170167754 CTGTCCCCTGGGGTGGTGTCCGG - Intergenic
1019635043 7:2070999-2071021 TTCATCCCAGGGCTGGTGGATGG + Intronic
1019635059 7:2071057-2071079 TTCATCCCAGGGCTGGTGGATGG + Intronic
1019701859 7:2477986-2478008 CTGTCCCTGGGGCTGGGGGCAGG - Intergenic
1019997763 7:4735627-4735649 CTTTCCGCCGGGCTGGTGGACGG + Intronic
1022094672 7:27131036-27131058 CCGGCCCCTGGGCTGGGGGAGGG + Intronic
1022909622 7:34887952-34887974 CTGTTCCCAGTGCTCCTGGAGGG + Intergenic
1023761376 7:43467999-43468021 CTGCACCCAGGGCTGGGGCATGG - Intronic
1023840906 7:44097016-44097038 CTCACCCCAGGGCTGGAGGGAGG + Intergenic
1023995423 7:45156604-45156626 GTGCCCCCAGGGGTGGTGGGTGG + Intergenic
1024512366 7:50213814-50213836 CTGACCCCAGGGCAGTGGGAGGG + Intergenic
1024537241 7:50447770-50447792 CTGTCACCCAGGCTGCTGGAGGG + Intronic
1026573561 7:71553288-71553310 CTGTCCCCCAGGCTGGAGGGAGG - Intronic
1026811736 7:73472977-73472999 CTGTCCCCCAGGCTGGAGTACGG + Intronic
1026830136 7:73605654-73605676 CCCTCCCCAGGTCGGGTGGACGG - Intronic
1026942802 7:74297438-74297460 CTGTCCCCCAGGCTGGAGGGTGG - Intronic
1026971767 7:74472890-74472912 CTGGCCCCACAGCTGGTGGGAGG + Intronic
1027200486 7:76061031-76061053 CTGACCCTAGGGCCGCTGGACGG + Intronic
1028725133 7:94077997-94078019 CTGTCTCCAGGGCTGGTTAGAGG - Intergenic
1029088828 7:98032379-98032401 CTGTCCCCAGGTCCAGTGCATGG - Intergenic
1029481904 7:100818491-100818513 CCCACCCCAGGGCTGGGGGATGG + Intronic
1030343718 7:108409558-108409580 CTGTCCTCAGGCCTGGTGCCTGG - Intronic
1030921441 7:115393667-115393689 CTGCCCCTAGGGCTGCTGTAGGG + Intergenic
1031123149 7:117743723-117743745 CTGTCACCAGGGCTGGAGTGTGG - Intronic
1032085325 7:128880655-128880677 CTGCCCCCATGGCTGGGCGAAGG - Exonic
1032389085 7:131544193-131544215 ATGTACACAGGGCTGGTGGCAGG - Intronic
1032396244 7:131592076-131592098 CTGTGGCCAGGGCTGAGGGAAGG + Intergenic
1033190805 7:139277024-139277046 CTGTCCCCCAGGCTGGAGGGCGG - Intronic
1033610731 7:142961303-142961325 TGGGCCCCAGGGCTGGGGGAGGG + Intronic
1035433244 7:158838207-158838229 CAATCCCCAGGGCTGGAGGTGGG - Intergenic
1035640897 8:1184509-1184531 CTGTTCTCAGGGCAGTTGGAGGG + Intergenic
1036695989 8:10975506-10975528 GTGTGCCCAGGGCAGGTGGTGGG - Intronic
1036761912 8:11515176-11515198 CTGTCCCCTGGGCTGGGTGGAGG + Intronic
1036774205 8:11598930-11598952 CTCTCCCCTGGGTTTGTGGATGG - Intergenic
1037436751 8:18871060-18871082 CTGTCCCCCGGGCCGGAGTATGG - Intronic
1037777617 8:21846198-21846220 TGGGCCCCTGGGCTGGTGGAAGG + Intergenic
1037880078 8:22569003-22569025 CTGCCCCCAGGGCTTGTGTCTGG + Intronic
1038005212 8:23424166-23424188 CTGGCCCCAGGGATGGGGGCAGG - Intronic
1038618093 8:29114494-29114516 CTGTCCTTAGGGGTGGTGAAGGG + Intronic
1040017198 8:42709230-42709252 CTGTGCCCTGGGCTGGTAGGGGG + Intronic
1040519106 8:48160035-48160057 CTCTCCCCAGAGCTGGTTGTGGG + Intergenic
1040874967 8:52141685-52141707 CTGTCCCCAAGGCTTCTGCAGGG - Intronic
1041750767 8:61258638-61258660 CTTTACCCAGGGCTGCTGAATGG + Intronic
1043386062 8:79748912-79748934 CTTTCTCCAGAGCTGGTGGAAGG - Intergenic
1043412645 8:80014535-80014557 CTGTCCCCAGAGCTGGTAAGCGG - Intronic
1045418886 8:101994401-101994423 CTGTTCCCAGGGCTCCTTGAGGG + Intronic
1045601190 8:103718814-103718836 ATGTACCCAGGGGTGGTGGCAGG - Intronic
1046207598 8:111021914-111021936 CTGTCCCCCAGGCTGGAGGGGGG - Intergenic
1046601277 8:116319770-116319792 CTGTCCACAGGGGCGGGGGAAGG + Intergenic
1047950787 8:129932980-129933002 CTATCCTCTGGGCTGGTGGAAGG + Intronic
1048179548 8:132182491-132182513 ATCTCCCCAGGGAGGGTGGAGGG + Intronic
1048330693 8:133468824-133468846 CTGCTGCCAGGGCTGGTGGGGGG + Intronic
1049151005 8:141035500-141035522 GTGGCACCAGGGCTGCTGGATGG - Intergenic
1049309619 8:141926693-141926715 CTGTCCCAGGGGCTGGAGGCTGG + Intergenic
1049945761 9:593916-593938 GTGTTCCCATGGCTGGGGGAGGG - Intronic
1050044163 9:1526117-1526139 CTACCCCCAGGGCTGAAGGAAGG - Intergenic
1050631220 9:7560793-7560815 CTGTTCCAAGGGCTGTGGGAAGG + Intergenic
1052379569 9:27755517-27755539 CTGTCGGCAGGGTTGGGGGAAGG + Intergenic
1052904073 9:33818063-33818085 CTGCCTCCAGGGATGGGGGAGGG - Intronic
1054714004 9:68539456-68539478 TGGTCCCAGGGGCTGGTGGAAGG - Intronic
1055440940 9:76335293-76335315 AGTTCCCCAGGGCTGGTGGGGGG + Intronic
1056955078 9:91074997-91075019 CTGCCCCCAGGGCTGATGTGAGG - Intergenic
1057024933 9:91727616-91727638 CTGACCCTAAGCCTGGTGGAAGG + Intronic
1057077371 9:92145441-92145463 CTGCCACCAGGGCTGAGGGAGGG + Intergenic
1057125330 9:92611788-92611810 GTGGCGCCGGGGCTGGTGGAGGG - Intronic
1057220530 9:93255382-93255404 CAGTGCCCAGAGCTGGTAGACGG + Intronic
1058886278 9:109323538-109323560 CTGTCCCCCAGGCTGGAGCACGG + Intergenic
1059413672 9:114149963-114149985 CTCTCCCCAGGGCAGGTGGCTGG - Intergenic
1059833799 9:118128178-118128200 CAGTCTCCAGTGCTGATGGAGGG + Intergenic
1060218732 9:121753463-121753485 CTTGACCCAGGGCTGGGGGACGG + Intronic
1060520258 9:124290339-124290361 CGGCCCCCAGGGCCTGTGGATGG + Intronic
1060809426 9:126602758-126602780 CTGTGCCCAGTCCTGGTGGGTGG + Intergenic
1060814523 9:126627582-126627604 CTTTCCCCAGAGCTGGAGCAGGG + Intronic
1060976556 9:127768336-127768358 CTGGCACCAGGGCTGGGGAAGGG + Intronic
1061003632 9:127916452-127916474 CTGTCTCCAGGGCTGGGGCTGGG + Exonic
1061246952 9:129405432-129405454 CCCTCCCCAGGGCTGGAGGGGGG + Intergenic
1061329924 9:129885911-129885933 GCGTGCCCAGGGCGGGTGGAGGG + Intergenic
1061813619 9:133179383-133179405 CTGTTACAAGGGCTGGTGCACGG + Intergenic
1061892191 9:133628570-133628592 AGGTGCCCAGGGCTGGGGGAGGG + Intergenic
1061918253 9:133768459-133768481 CGGAGACCAGGGCTGGTGGAAGG - Exonic
1061964992 9:134008397-134008419 CTGTCCCCCAGGCTGGAGTACGG + Intergenic
1062150130 9:135013902-135013924 CTGGCCTCAGGGCTCCTGGAGGG - Intergenic
1062200237 9:135299002-135299024 TTTTCCCCAGGGATCGTGGACGG - Intergenic
1062448551 9:136606000-136606022 CTGTGCCCAGGCCGGGAGGAGGG + Intergenic
1203785907 EBV:127459-127481 CTGTCCCGATGGCAGGTGCACGG - Intergenic
1186380650 X:9055132-9055154 CTGTCCCCAGGCCGTGGGGAAGG + Intronic
1186488272 X:9950856-9950878 CTGTCGCCCGGGCTGGAGTACGG + Intergenic
1187254449 X:17629596-17629618 CTGGCATCAGGCCTGGTGGATGG + Intronic
1187542735 X:20214058-20214080 CTTTCCCCAAGAATGGTGGAAGG - Intronic
1187950596 X:24466224-24466246 CTGTCCGGTGGGCTGGTGGGCGG + Intronic
1188450182 X:30300960-30300982 CTGTTTCCAGGGCTGGAGCAAGG + Intergenic
1188520265 X:31030582-31030604 TTGTTACCATGGCTGGTGGAGGG + Intergenic
1188713216 X:33428166-33428188 CTGTCCCCAGAGATGGAGAATGG - Intergenic
1189094188 X:38120734-38120756 CTTCCCCCAGGGTTGGGGGAAGG + Intronic
1189257852 X:39654280-39654302 TTGTGCCCAGGGCTGGGGGATGG + Intergenic
1189773341 X:44447716-44447738 CTGTCACCCAGGCTGGTGTATGG + Intergenic
1189987956 X:46570735-46570757 CTGTCACCCAGGCTGGTGGAAGG - Intergenic
1190019796 X:46863735-46863757 ATGTCCCCAGGGGTGTGGGAGGG + Intronic
1190098293 X:47500384-47500406 CAGTTCCCAGGGCTGGAGCAAGG + Intergenic
1190732118 X:53233311-53233333 CTCTCCCCAGGGCTGATGCTGGG + Exonic
1191854337 X:65611039-65611061 GTTTCCCTAGGCCTGGTGGAAGG - Intronic
1195031402 X:100930495-100930517 CTTTCCCCAGGGCTGATTCAGGG + Intergenic
1195172501 X:102282403-102282425 CTGTGGCCAGGGGTGGGGGAGGG + Intergenic
1195186365 X:102404692-102404714 CTGTGGCCAGGGGTGGGGGAGGG - Intronic
1195632781 X:107076543-107076565 TAGTCACCAGGGCTGGGGGAAGG + Intronic
1195933411 X:110102313-110102335 CTGTCACCCAGGCTGGAGGACGG - Intronic
1196867937 X:120086355-120086377 CTGTCCCAAGGGCTGAGGAATGG - Intergenic
1196875165 X:120149926-120149948 CTGTCCCAAGGGCTGAGGAATGG + Intergenic
1198415404 X:136414789-136414811 CTGGCCCCAGTTCTGCTGGATGG - Intronic
1198622813 X:138533314-138533336 TAGTCCCCAGTGCTGGAGGAGGG + Intergenic
1198734417 X:139770814-139770836 GTGTCCTCAGGGCTGTTGAATGG + Intronic
1200022338 X:153222490-153222512 CTGTGCCCAGGGCAGCTGGCTGG + Intergenic
1200155404 X:153972290-153972312 CTGTCCCCAGTGCTGGTTAAAGG - Intergenic
1200357524 X:155567717-155567739 CATGCCACAGGGCTGGTGGAAGG - Intronic