ID: 1152929147

View in Genome Browser
Species Human (GRCh38)
Location 17:83101125-83101147
Sequence GGGACCACTCAAGAGTAGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152929147_1152929161 16 Left 1152929147 17:83101125-83101147 CCCGGCTACTCTTGAGTGGTCCC No data
Right 1152929161 17:83101164-83101186 CCGGTTCCACCTGGAGCCGTGGG No data
1152929147_1152929151 -3 Left 1152929147 17:83101125-83101147 CCCGGCTACTCTTGAGTGGTCCC No data
Right 1152929151 17:83101145-83101167 CCCCAGGCTCCTCCTCCTCCCGG No data
1152929147_1152929166 27 Left 1152929147 17:83101125-83101147 CCCGGCTACTCTTGAGTGGTCCC No data
Right 1152929166 17:83101175-83101197 TGGAGCCGTGGGGCTGTGCCGGG No data
1152929147_1152929155 7 Left 1152929147 17:83101125-83101147 CCCGGCTACTCTTGAGTGGTCCC No data
Right 1152929155 17:83101155-83101177 CTCCTCCTCCCGGTTCCACCTGG No data
1152929147_1152929167 28 Left 1152929147 17:83101125-83101147 CCCGGCTACTCTTGAGTGGTCCC No data
Right 1152929167 17:83101176-83101198 GGAGCCGTGGGGCTGTGCCGGGG No data
1152929147_1152929159 15 Left 1152929147 17:83101125-83101147 CCCGGCTACTCTTGAGTGGTCCC No data
Right 1152929159 17:83101163-83101185 CCCGGTTCCACCTGGAGCCGTGG No data
1152929147_1152929165 26 Left 1152929147 17:83101125-83101147 CCCGGCTACTCTTGAGTGGTCCC No data
Right 1152929165 17:83101174-83101196 CTGGAGCCGTGGGGCTGTGCCGG No data
1152929147_1152929162 17 Left 1152929147 17:83101125-83101147 CCCGGCTACTCTTGAGTGGTCCC No data
Right 1152929162 17:83101165-83101187 CGGTTCCACCTGGAGCCGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152929147 Original CRISPR GGGACCACTCAAGAGTAGCC GGG (reversed) Intergenic
No off target data available for this crispr