ID: 1152930934

View in Genome Browser
Species Human (GRCh38)
Location 17:83109561-83109583
Sequence TGGCCTGGCCTCAGTCCCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152930925_1152930934 5 Left 1152930925 17:83109533-83109555 CCTGTGCCTGTGGGGTCCTCTCC No data
Right 1152930934 17:83109561-83109583 TGGCCTGGCCTCAGTCCCACTGG No data
1152930924_1152930934 6 Left 1152930924 17:83109532-83109554 CCCTGTGCCTGTGGGGTCCTCTC No data
Right 1152930934 17:83109561-83109583 TGGCCTGGCCTCAGTCCCACTGG No data
1152930928_1152930934 -1 Left 1152930928 17:83109539-83109561 CCTGTGGGGTCCTCTCCGGGCCT No data
Right 1152930934 17:83109561-83109583 TGGCCTGGCCTCAGTCCCACTGG No data
1152930923_1152930934 7 Left 1152930923 17:83109531-83109553 CCCCTGTGCCTGTGGGGTCCTCT No data
Right 1152930934 17:83109561-83109583 TGGCCTGGCCTCAGTCCCACTGG No data
1152930922_1152930934 8 Left 1152930922 17:83109530-83109552 CCCCCTGTGCCTGTGGGGTCCTC No data
Right 1152930934 17:83109561-83109583 TGGCCTGGCCTCAGTCCCACTGG No data
1152930918_1152930934 22 Left 1152930918 17:83109516-83109538 CCTGCGTGCAGACGCCCCCTGTG No data
Right 1152930934 17:83109561-83109583 TGGCCTGGCCTCAGTCCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152930934 Original CRISPR TGGCCTGGCCTCAGTCCCAC TGG Intergenic
No off target data available for this crispr