ID: 1152940021

View in Genome Browser
Species Human (GRCh38)
Location 17:83164100-83164122
Sequence GCTCCTGTTGCTACACATCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152940019_1152940021 -4 Left 1152940019 17:83164081-83164103 CCAGCAGCCGTGAACGAGAGCTC No data
Right 1152940021 17:83164100-83164122 GCTCCTGTTGCTACACATCCTGG No data
1152940018_1152940021 -3 Left 1152940018 17:83164080-83164102 CCCAGCAGCCGTGAACGAGAGCT No data
Right 1152940021 17:83164100-83164122 GCTCCTGTTGCTACACATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152940021 Original CRISPR GCTCCTGTTGCTACACATCC TGG Intergenic
No off target data available for this crispr