ID: 1152941288

View in Genome Browser
Species Human (GRCh38)
Location 17:83174006-83174028
Sequence CGCCTCGTCGGGGCCTCCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152941288_1152941296 -4 Left 1152941288 17:83174006-83174028 CCCCTGGAGGCCCCGACGAGGCG No data
Right 1152941296 17:83174025-83174047 GGCGGCCCTTGAGGTTCAACTGG No data
1152941288_1152941302 29 Left 1152941288 17:83174006-83174028 CCCCTGGAGGCCCCGACGAGGCG No data
Right 1152941302 17:83174058-83174080 CCTGACCCCTGAGCAGAGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152941288 Original CRISPR CGCCTCGTCGGGGCCTCCAG GGG (reversed) Intergenic