ID: 1152941905

View in Genome Browser
Species Human (GRCh38)
Location 17:83177222-83177244
Sequence CCTGCAGAGCCTGCTGGAGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152941898_1152941905 16 Left 1152941898 17:83177183-83177205 CCTACAGGGGAGCCTGGGACGTG No data
Right 1152941905 17:83177222-83177244 CCTGCAGAGCCTGCTGGAGCCGG No data
1152941901_1152941905 4 Left 1152941901 17:83177195-83177217 CCTGGGACGTGGGCTTCTGTTCC No data
Right 1152941905 17:83177222-83177244 CCTGCAGAGCCTGCTGGAGCCGG No data
1152941893_1152941905 29 Left 1152941893 17:83177170-83177192 CCAACGCTACCTGCCTACAGGGG No data
Right 1152941905 17:83177222-83177244 CCTGCAGAGCCTGCTGGAGCCGG No data
1152941891_1152941905 30 Left 1152941891 17:83177169-83177191 CCCAACGCTACCTGCCTACAGGG No data
Right 1152941905 17:83177222-83177244 CCTGCAGAGCCTGCTGGAGCCGG No data
1152941897_1152941905 20 Left 1152941897 17:83177179-83177201 CCTGCCTACAGGGGAGCCTGGGA No data
Right 1152941905 17:83177222-83177244 CCTGCAGAGCCTGCTGGAGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152941905 Original CRISPR CCTGCAGAGCCTGCTGGAGC CGG Intergenic
No off target data available for this crispr