ID: 1152944122

View in Genome Browser
Species Human (GRCh38)
Location 17:83189817-83189839
Sequence CTCCAGCAGCAGGCAGGCTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152944122_1152944131 8 Left 1152944122 17:83189817-83189839 CCGGAGCCTGCCTGCTGCTGGAG No data
Right 1152944131 17:83189848-83189870 GTTTGGAGTGGGGCTCTCGGCGG No data
1152944122_1152944130 5 Left 1152944122 17:83189817-83189839 CCGGAGCCTGCCTGCTGCTGGAG No data
Right 1152944130 17:83189845-83189867 TGTGTTTGGAGTGGGGCTCTCGG No data
1152944122_1152944128 -3 Left 1152944122 17:83189817-83189839 CCGGAGCCTGCCTGCTGCTGGAG No data
Right 1152944128 17:83189837-83189859 GAGACGGCTGTGTTTGGAGTGGG No data
1152944122_1152944127 -4 Left 1152944122 17:83189817-83189839 CCGGAGCCTGCCTGCTGCTGGAG No data
Right 1152944127 17:83189836-83189858 GGAGACGGCTGTGTTTGGAGTGG No data
1152944122_1152944132 16 Left 1152944122 17:83189817-83189839 CCGGAGCCTGCCTGCTGCTGGAG No data
Right 1152944132 17:83189856-83189878 TGGGGCTCTCGGCGGTGCTGAGG No data
1152944122_1152944126 -9 Left 1152944122 17:83189817-83189839 CCGGAGCCTGCCTGCTGCTGGAG No data
Right 1152944126 17:83189831-83189853 CTGCTGGAGACGGCTGTGTTTGG No data
1152944122_1152944129 -2 Left 1152944122 17:83189817-83189839 CCGGAGCCTGCCTGCTGCTGGAG No data
Right 1152944129 17:83189838-83189860 AGACGGCTGTGTTTGGAGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152944122 Original CRISPR CTCCAGCAGCAGGCAGGCTC CGG (reversed) Intergenic
No off target data available for this crispr