ID: 1152944303

View in Genome Browser
Species Human (GRCh38)
Location 17:83190766-83190788
Sequence AGTGGCACTCAGCAGGAACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152944303_1152944310 9 Left 1152944303 17:83190766-83190788 CCCAGTTCCTGCTGAGTGCCACT No data
Right 1152944310 17:83190798-83190820 AGCTGCTCCCATCCAGTGCTGGG No data
1152944303_1152944309 8 Left 1152944303 17:83190766-83190788 CCCAGTTCCTGCTGAGTGCCACT No data
Right 1152944309 17:83190797-83190819 CAGCTGCTCCCATCCAGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152944303 Original CRISPR AGTGGCACTCAGCAGGAACT GGG (reversed) Intergenic