ID: 1152944466

View in Genome Browser
Species Human (GRCh38)
Location 17:83191491-83191513
Sequence ATGTCTCTCTCCCAGAATTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152944466_1152944468 13 Left 1152944466 17:83191491-83191513 CCTTAATTCTGGGAGAGAGACAT No data
Right 1152944468 17:83191527-83191549 GTGCCATAACTGCCTCTTTGTGG No data
1152944466_1152944467 -9 Left 1152944466 17:83191491-83191513 CCTTAATTCTGGGAGAGAGACAT No data
Right 1152944467 17:83191505-83191527 GAGAGACATCTTCACTTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152944466 Original CRISPR ATGTCTCTCTCCCAGAATTA AGG (reversed) Intergenic
No off target data available for this crispr