ID: 1152945146

View in Genome Browser
Species Human (GRCh38)
Location 17:83194051-83194073
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152945140_1152945146 7 Left 1152945140 17:83194021-83194043 CCTGTGTGTTAAAATGCTTCAGA No data
Right 1152945146 17:83194051-83194073 CAGCCCAGGAACGTGGGGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152945146 Original CRISPR CAGCCCAGGAACGTGGGGGT TGG Intergenic
No off target data available for this crispr