ID: 1152947175

View in Genome Browser
Species Human (GRCh38)
Location 17:83204136-83204158
Sequence GGCTGTGTATGGGGGGAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152947167_1152947175 -4 Left 1152947167 17:83204117-83204139 CCCAGGAGGGTGTGTCCGGGGCT No data
Right 1152947175 17:83204136-83204158 GGCTGTGTATGGGGGGAAGCTGG No data
1152947161_1152947175 5 Left 1152947161 17:83204108-83204130 CCACATTCCCCCAGGAGGGTGTG No data
Right 1152947175 17:83204136-83204158 GGCTGTGTATGGGGGGAAGCTGG No data
1152947164_1152947175 -2 Left 1152947164 17:83204115-83204137 CCCCCAGGAGGGTGTGTCCGGGG No data
Right 1152947175 17:83204136-83204158 GGCTGTGTATGGGGGGAAGCTGG No data
1152947166_1152947175 -3 Left 1152947166 17:83204116-83204138 CCCCAGGAGGGTGTGTCCGGGGC No data
Right 1152947175 17:83204136-83204158 GGCTGTGTATGGGGGGAAGCTGG No data
1152947158_1152947175 9 Left 1152947158 17:83204104-83204126 CCCACCACATTCCCCCAGGAGGG No data
Right 1152947175 17:83204136-83204158 GGCTGTGTATGGGGGGAAGCTGG No data
1152947160_1152947175 8 Left 1152947160 17:83204105-83204127 CCACCACATTCCCCCAGGAGGGT No data
Right 1152947175 17:83204136-83204158 GGCTGTGTATGGGGGGAAGCTGG No data
1152947168_1152947175 -5 Left 1152947168 17:83204118-83204140 CCAGGAGGGTGTGTCCGGGGCTG No data
Right 1152947175 17:83204136-83204158 GGCTGTGTATGGGGGGAAGCTGG No data
1152947155_1152947175 27 Left 1152947155 17:83204086-83204108 CCTGCGGTCAGTGCGGAGCCCAC No data
Right 1152947175 17:83204136-83204158 GGCTGTGTATGGGGGGAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152947175 Original CRISPR GGCTGTGTATGGGGGGAAGC TGG Intergenic
No off target data available for this crispr