ID: 1152947864

View in Genome Browser
Species Human (GRCh38)
Location 17:83207690-83207712
Sequence TGACAAGTCAGAGGACTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152947864_1152947872 28 Left 1152947864 17:83207690-83207712 CCTTCCAGTCCTCTGACTTGTCA No data
Right 1152947872 17:83207741-83207763 CCCCATAGAGAGCTCCTGAAGGG No data
1152947864_1152947876 30 Left 1152947864 17:83207690-83207712 CCTTCCAGTCCTCTGACTTGTCA No data
Right 1152947876 17:83207743-83207765 CCATAGAGAGCTCCTGAAGGGGG No data
1152947864_1152947870 27 Left 1152947864 17:83207690-83207712 CCTTCCAGTCCTCTGACTTGTCA No data
Right 1152947870 17:83207740-83207762 ACCCCATAGAGAGCTCCTGAAGG No data
1152947864_1152947874 29 Left 1152947864 17:83207690-83207712 CCTTCCAGTCCTCTGACTTGTCA No data
Right 1152947874 17:83207742-83207764 CCCATAGAGAGCTCCTGAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152947864 Original CRISPR TGACAAGTCAGAGGACTGGA AGG (reversed) Intergenic
No off target data available for this crispr