ID: 1152947876

View in Genome Browser
Species Human (GRCh38)
Location 17:83207743-83207765
Sequence CCATAGAGAGCTCCTGAAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152947869_1152947876 -3 Left 1152947869 17:83207723-83207745 CCAAATCTTGCACTTTAACCCCA No data
Right 1152947876 17:83207743-83207765 CCATAGAGAGCTCCTGAAGGGGG No data
1152947864_1152947876 30 Left 1152947864 17:83207690-83207712 CCTTCCAGTCCTCTGACTTGTCA No data
Right 1152947876 17:83207743-83207765 CCATAGAGAGCTCCTGAAGGGGG No data
1152947868_1152947876 -2 Left 1152947868 17:83207722-83207744 CCCAAATCTTGCACTTTAACCCC No data
Right 1152947876 17:83207743-83207765 CCATAGAGAGCTCCTGAAGGGGG No data
1152947865_1152947876 26 Left 1152947865 17:83207694-83207716 CCAGTCCTCTGACTTGTCATTTT No data
Right 1152947876 17:83207743-83207765 CCATAGAGAGCTCCTGAAGGGGG No data
1152947866_1152947876 21 Left 1152947866 17:83207699-83207721 CCTCTGACTTGTCATTTTTCTAC No data
Right 1152947876 17:83207743-83207765 CCATAGAGAGCTCCTGAAGGGGG No data
1152947867_1152947876 -1 Left 1152947867 17:83207721-83207743 CCCCAAATCTTGCACTTTAACCC No data
Right 1152947876 17:83207743-83207765 CCATAGAGAGCTCCTGAAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152947876 Original CRISPR CCATAGAGAGCTCCTGAAGG GGG Intergenic
No off target data available for this crispr