ID: 1152947878

View in Genome Browser
Species Human (GRCh38)
Location 17:83207755-83207777
Sequence CCTGAAGGGGGAATTTTAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152947869_1152947878 9 Left 1152947869 17:83207723-83207745 CCAAATCTTGCACTTTAACCCCA No data
Right 1152947878 17:83207755-83207777 CCTGAAGGGGGAATTTTAACTGG No data
1152947867_1152947878 11 Left 1152947867 17:83207721-83207743 CCCCAAATCTTGCACTTTAACCC No data
Right 1152947878 17:83207755-83207777 CCTGAAGGGGGAATTTTAACTGG No data
1152947868_1152947878 10 Left 1152947868 17:83207722-83207744 CCCAAATCTTGCACTTTAACCCC No data
Right 1152947878 17:83207755-83207777 CCTGAAGGGGGAATTTTAACTGG No data
1152947873_1152947878 -10 Left 1152947873 17:83207742-83207764 CCCATAGAGAGCTCCTGAAGGGG No data
Right 1152947878 17:83207755-83207777 CCTGAAGGGGGAATTTTAACTGG No data
1152947871_1152947878 -9 Left 1152947871 17:83207741-83207763 CCCCATAGAGAGCTCCTGAAGGG No data
Right 1152947878 17:83207755-83207777 CCTGAAGGGGGAATTTTAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152947878 Original CRISPR CCTGAAGGGGGAATTTTAAC TGG Intergenic
No off target data available for this crispr