ID: 1152952845

View in Genome Browser
Species Human (GRCh38)
Location 18:11082-11104
Sequence CTCCGCGCCTGCGCCTGCGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152952845_1152952851 5 Left 1152952845 18:11082-11104 CCGGCGCAGGCGCAGGCGCGGAG No data
Right 1152952851 18:11110-11132 CGCAGCGCCGGCGCAGGCGCAGG No data
1152952845_1152952849 -7 Left 1152952845 18:11082-11104 CCGGCGCAGGCGCAGGCGCGGAG No data
Right 1152952849 18:11098-11120 CGCGGAGGGGCGCGCAGCGCCGG No data
1152952845_1152952856 15 Left 1152952845 18:11082-11104 CCGGCGCAGGCGCAGGCGCGGAG No data
Right 1152952856 18:11120-11142 GCGCAGGCGCAGGCGCGGAGGGG No data
1152952845_1152952854 13 Left 1152952845 18:11082-11104 CCGGCGCAGGCGCAGGCGCGGAG No data
Right 1152952854 18:11118-11140 CGGCGCAGGCGCAGGCGCGGAGG No data
1152952845_1152952855 14 Left 1152952845 18:11082-11104 CCGGCGCAGGCGCAGGCGCGGAG No data
Right 1152952855 18:11119-11141 GGCGCAGGCGCAGGCGCGGAGGG No data
1152952845_1152952852 10 Left 1152952845 18:11082-11104 CCGGCGCAGGCGCAGGCGCGGAG No data
Right 1152952852 18:11115-11137 CGCCGGCGCAGGCGCAGGCGCGG No data
1152952845_1152952850 -1 Left 1152952845 18:11082-11104 CCGGCGCAGGCGCAGGCGCGGAG No data
Right 1152952850 18:11104-11126 GGGGCGCGCAGCGCCGGCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152952845 Original CRISPR CTCCGCGCCTGCGCCTGCGC CGG (reversed) Intergenic