ID: 1152952853 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 18:11117-11139 |
| Sequence | CTCCGCGCCTGCGCCTGCGC CGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1152952853_1152952863 | 23 | Left | 1152952853 | 18:11117-11139 | CCGGCGCAGGCGCAGGCGCGGAG | No data | ||
| Right | 1152952863 | 18:11163-11185 | AATGCCGTCATAAGAGCCCTAGG | No data | ||||
| 1152952853_1152952864 | 24 | Left | 1152952853 | 18:11117-11139 | CCGGCGCAGGCGCAGGCGCGGAG | No data | ||
| Right | 1152952864 | 18:11164-11186 | ATGCCGTCATAAGAGCCCTAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1152952853 | Original CRISPR | CTCCGCGCCTGCGCCTGCGC CGG (reversed) | Intergenic | ||