ID: 1152952853

View in Genome Browser
Species Human (GRCh38)
Location 18:11117-11139
Sequence CTCCGCGCCTGCGCCTGCGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152952853_1152952863 23 Left 1152952853 18:11117-11139 CCGGCGCAGGCGCAGGCGCGGAG No data
Right 1152952863 18:11163-11185 AATGCCGTCATAAGAGCCCTAGG No data
1152952853_1152952864 24 Left 1152952853 18:11117-11139 CCGGCGCAGGCGCAGGCGCGGAG No data
Right 1152952864 18:11164-11186 ATGCCGTCATAAGAGCCCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152952853 Original CRISPR CTCCGCGCCTGCGCCTGCGC CGG (reversed) Intergenic