ID: 1152954669

View in Genome Browser
Species Human (GRCh38)
Location 18:28335-28357
Sequence TCCAGCTGGCCAGCAGCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152954662_1152954669 11 Left 1152954662 18:28301-28323 CCACAGCACCTCACAAGTCCCAT No data
Right 1152954669 18:28335-28357 TCCAGCTGGCCAGCAGCAGCAGG No data
1152954660_1152954669 17 Left 1152954660 18:28295-28317 CCACTCCCACAGCACCTCACAAG No data
Right 1152954669 18:28335-28357 TCCAGCTGGCCAGCAGCAGCAGG No data
1152954659_1152954669 18 Left 1152954659 18:28294-28316 CCCACTCCCACAGCACCTCACAA No data
Right 1152954669 18:28335-28357 TCCAGCTGGCCAGCAGCAGCAGG No data
1152954666_1152954669 -7 Left 1152954666 18:28319-28341 CCCATTGGCTTGGAATTCCAGCT No data
Right 1152954669 18:28335-28357 TCCAGCTGGCCAGCAGCAGCAGG No data
1152954667_1152954669 -8 Left 1152954667 18:28320-28342 CCATTGGCTTGGAATTCCAGCTG No data
Right 1152954669 18:28335-28357 TCCAGCTGGCCAGCAGCAGCAGG No data
1152954664_1152954669 3 Left 1152954664 18:28309-28331 CCTCACAAGTCCCATTGGCTTGG No data
Right 1152954669 18:28335-28357 TCCAGCTGGCCAGCAGCAGCAGG No data
1152954661_1152954669 12 Left 1152954661 18:28300-28322 CCCACAGCACCTCACAAGTCCCA No data
Right 1152954669 18:28335-28357 TCCAGCTGGCCAGCAGCAGCAGG No data
1152954658_1152954669 19 Left 1152954658 18:28293-28315 CCCCACTCCCACAGCACCTCACA No data
Right 1152954669 18:28335-28357 TCCAGCTGGCCAGCAGCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152954669 Original CRISPR TCCAGCTGGCCAGCAGCAGC AGG Intergenic
No off target data available for this crispr