ID: 1152956843

View in Genome Browser
Species Human (GRCh38)
Location 18:47769-47791
Sequence ACGGTGGCTGCCATTTTCAG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 2, 1: 4, 2: 6, 3: 18, 4: 113}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152956843_1152956850 -3 Left 1152956843 18:47769-47791 CCCCTGAAAATGGCAGCCACCGT 0: 2
1: 4
2: 6
3: 18
4: 113
Right 1152956850 18:47789-47811 CGTTAGGTAGCAGCCGTGACGGG 0: 1
1: 4
2: 5
3: 2
4: 26
1152956843_1152956849 -4 Left 1152956843 18:47769-47791 CCCCTGAAAATGGCAGCCACCGT 0: 2
1: 4
2: 6
3: 18
4: 113
Right 1152956849 18:47788-47810 CCGTTAGGTAGCAGCCGTGACGG 0: 1
1: 4
2: 3
3: 3
4: 29
1152956843_1152956852 -1 Left 1152956843 18:47769-47791 CCCCTGAAAATGGCAGCCACCGT 0: 2
1: 4
2: 6
3: 18
4: 113
Right 1152956852 18:47791-47813 TTAGGTAGCAGCCGTGACGGGGG 0: 1
1: 5
2: 3
3: 5
4: 69
1152956843_1152956853 6 Left 1152956843 18:47769-47791 CCCCTGAAAATGGCAGCCACCGT 0: 2
1: 4
2: 6
3: 18
4: 113
Right 1152956853 18:47798-47820 GCAGCCGTGACGGGGGTCACAGG 0: 1
1: 5
2: 1
3: 9
4: 101
1152956843_1152956851 -2 Left 1152956843 18:47769-47791 CCCCTGAAAATGGCAGCCACCGT 0: 2
1: 4
2: 6
3: 18
4: 113
Right 1152956851 18:47790-47812 GTTAGGTAGCAGCCGTGACGGGG 0: 1
1: 4
2: 3
3: 8
4: 31

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152956843 Original CRISPR ACGGTGGCTGCCATTTTCAG GGG (reversed) Exonic
900083122 1:873948-873970 ACGGCGGCTGCCATTTTCCAGGG + Intergenic
907742000 1:57175815-57175837 ACTGGGGCTGCCATTTTGATGGG - Intronic
911552996 1:99306670-99306692 GCGAAGGCTGCCCTTTTCAGGGG - Exonic
918464360 1:184806487-184806509 ACAGTGGCTGACATGTTCATGGG + Intronic
920787948 1:209060672-209060694 ATGGTGGCTGCCCTTTCTAGTGG + Intergenic
922668724 1:227493343-227493365 ACAGTGGCTGCCGTTTTCAGAGG - Intergenic
922670872 1:227507956-227507978 ACAGTGGCTGCCGTTTTCAGAGG + Intergenic
924243307 1:242059886-242059908 ATGGTGGCTGCCATTTTCAGAGG + Intergenic
1062763935 10:47436-47458 ACGGCGGCTGCCATTTTCAGGGG - Exonic
1068474974 10:57513334-57513356 ACAGTGGCTGCTGTTTTCAGGGG + Intergenic
1069488571 10:68842100-68842122 ATGGTGGCTGCCATTTATAAGGG - Intronic
1074877233 10:117622817-117622839 CCTGTGGCTGGCATTTGCAGGGG + Intergenic
1084935702 11:72585493-72585515 ATGGGGGCTGGCATTTGCAGAGG - Intronic
1085451464 11:76636554-76636576 AGGGTGGCTGCCAGTGTCAATGG + Intergenic
1087205440 11:95389021-95389043 ATGTTGGCTGCCTTTTTCACAGG + Intergenic
1087365044 11:97208220-97208242 ACCTTGACTGCCATTTTGAGAGG - Intergenic
1089682790 11:120128818-120128840 AGGGTGCTTGCCCTTTTCAGTGG + Intronic
1091109339 11:132951157-132951179 ACGGTGGTCTCCATTTACAGAGG - Intronic
1091694193 12:2616965-2616987 GACGTGGCTGGCATTTTCAGAGG + Intronic
1092277170 12:7070196-7070218 ACGGTGGGTCCCATTTTCACTGG - Exonic
1094813770 12:34165141-34165163 ATGGCAGCAGCCATTTTCAGGGG - Intergenic
1095103154 12:38203380-38203402 ATGGCGGCTGCCATTTTCAGGGG + Intergenic
1096525069 12:52205513-52205535 GCAGTGGCTGCCATTTACTGAGG + Intergenic
1101869589 12:108553964-108553986 AAGCTGGCTGCCATGTTGAGAGG - Intronic
1102638123 12:114342358-114342380 ACTGAGGCTGCCCTTTTCAGAGG - Intergenic
1104256294 12:127142602-127142624 AGGGTGGCTGCAATTTGCTGGGG + Intergenic
1105592624 13:21808739-21808761 ATGGTGGCTACCATTGGCAGGGG + Intergenic
1107636874 13:42401024-42401046 AAGGTAGCTGCCATGTTCTGGGG - Intergenic
1107918948 13:45183381-45183403 ACTGTGGCTTCCATCCTCAGGGG + Intronic
1108071972 13:46637345-46637367 AGGGTGGCTCACATTTTCATAGG - Intronic
1109700733 13:66021436-66021458 ACAGTGGCTGCAATTTTGAGAGG - Intergenic
1111921220 13:94413175-94413197 AGGGTGGCACCCATTTTCAGTGG - Intergenic
1116307367 14:43275294-43275316 ACAGTTCCTGCCATTTTCAGAGG + Intergenic
1117987903 14:61406541-61406563 ACTGTGGCTCCCATTTTAACTGG - Intronic
1118415373 14:65529631-65529653 GTGGTGGCTGCTATTTTGAGGGG + Intronic
1120844400 14:89113201-89113223 ATGGTGGCTTTCATTTTGAGTGG - Intergenic
1121335339 14:93074576-93074598 GCTGTGGGAGCCATTTTCAGAGG - Intronic
1124139550 15:27065115-27065137 ACGTTGGCTGCCACTCTCAATGG + Intronic
1126427632 15:48546653-48546675 ACAGTGGCTTTTATTTTCAGTGG - Intronic
1128261742 15:66237477-66237499 ACAATGGCTGCCGTTTTAAGGGG + Intronic
1133378826 16:5313005-5313027 ACTGAGCCTGCCATTCTCAGTGG - Intergenic
1133640756 16:7715011-7715033 AGGCTGGCTGGCATTTTCTGTGG + Intergenic
1141352745 16:83313518-83313540 AGTGTGTCTGCCATTTTTAGAGG + Intronic
1141941071 16:87276571-87276593 ACAGTGCCTGCCATTCTAAGGGG - Intronic
1142440713 16:90095791-90095813 ACGGTGGCTGCCATTTTCAGGGG + Intergenic
1143028707 17:3955446-3955468 GCAGTGGCTGACATTTTCCGTGG + Intronic
1144733777 17:17543429-17543451 AAGGTGGCTGCCCTTTGAAGGGG + Intronic
1145265546 17:21378062-21378084 AAGGCGGCTGCCGATTTCAGTGG - Intronic
1147727174 17:42573250-42573272 CTGGTGCCTGCCATTTTCAAAGG + Intronic
1151504423 17:74517201-74517223 GCAGTGGCTGCCATGATCAGTGG + Intergenic
1152916169 17:83037255-83037277 ACGGGGGCTGCCCTGTTCCGGGG + Intronic
1152956843 18:47769-47791 ACGGTGGCTGCCATTTTCAGGGG - Exonic
1156468025 18:37360343-37360365 CCGGTGGGTGCCAGTGTCAGGGG - Intronic
1162091782 19:8285065-8285087 ACAGTGGCTGCCATCATCTGGGG - Intronic
1162094018 19:8299914-8299936 ACAGTGGCTGCCATCATCTGGGG - Intronic
1162749788 19:12822034-12822056 ACCGTAGCTGCCATGTTGAGAGG + Intronic
1167781701 19:51602582-51602604 AGGGTTGCTTCTATTTTCAGAGG - Intergenic
926521289 2:13918243-13918265 ATGGTGGCTATGATTTTCAGTGG - Intergenic
929849439 2:45570713-45570735 ACGTGGGCTGTCATCTTCAGAGG - Intronic
933730242 2:85450763-85450785 ACAGAGGCTGCCATTTTTAGTGG - Intergenic
934499705 2:94847591-94847613 ATGGTGGCTAGCACTTTCAGAGG + Intergenic
935465149 2:103388175-103388197 CGGCTGACTGCCATTTTCAGTGG + Intergenic
937415934 2:121714528-121714550 AGTGGGACTGCCATTTTCAGTGG - Intergenic
937647381 2:124280849-124280871 ATGGTGGCTTCCTTTCTCAGGGG - Intronic
944064429 2:195603762-195603784 ACAGTGCCTGACATTCTCAGTGG - Intronic
944938227 2:204592242-204592264 AAGGTGGCTGTCATTTTCCATGG + Intronic
1168733586 20:109949-109971 ATGGTGCCAGCCATTTTCAGTGG + Intergenic
1169067563 20:2702723-2702745 ACTGTGGCAGCCATTGTCACAGG + Intronic
1171890932 20:30714305-30714327 ATGGTGGCTAGCACTTTCAGAGG + Intergenic
1173394585 20:42667410-42667432 ACAGTGGCTGCCAATTTGAGGGG - Intronic
1175401908 20:58705582-58705604 ACGGTCTCTGCCTTTTTCACGGG - Intronic
1178367953 21:32003116-32003138 AGAGTGGCTGCCATGGTCAGAGG + Exonic
1179394542 21:41026331-41026353 ACGGTGGCTGCCACATTCTATGG + Intergenic
1179830478 21:43993269-43993291 AAGGTGGCTGCCACTTCCAGCGG + Intergenic
1179937544 21:44614776-44614798 ACCGTGGCTTCCTTTTTCACTGG - Intronic
1183170776 22:36186276-36186298 ACGGTGGCAGCAATGGTCAGTGG + Intergenic
1183506189 22:38210243-38210265 ACAGTGGCTGCCCCTGTCAGGGG + Intronic
1184424946 22:44403875-44403897 ACGGGGGCTGCAACTCTCAGAGG + Intergenic
1184857239 22:47153084-47153106 TCTGTGGCTTCCATTCTCAGAGG + Intronic
950117782 3:10462491-10462513 ACAGTGACTGCCATTTAGAGTGG + Intronic
954719525 3:52549420-52549442 ACGGTGGCTCCCACTTTGGGAGG - Intronic
955802018 3:62696324-62696346 ACTGTGGCTGCCAGTGGCAGGGG - Intronic
957849912 3:85794303-85794325 ACAATGGCTGGCATTTGCAGGGG - Intronic
958544413 3:95523632-95523654 ACAGTGGCTCACACTTTCAGAGG + Intergenic
965862410 3:173162576-173162598 ACGGTTTCTGCCATATGCAGGGG - Intergenic
966835139 3:184043979-184044001 CCTGTGGCTGCCACTTTCACAGG - Intergenic
968357469 3:198120378-198120400 ATGGCGGCTGCCATTTTCCAGGG + Intergenic
971298219 4:25419634-25419656 ACAGTGGCTTCCATTCACAGAGG - Intergenic
978735360 4:112078011-112078033 ATGGCAGCTGCCATTTTCAGGGG + Intergenic
979808747 4:125009110-125009132 ATGGTCTATGCCATTTTCAGAGG + Intergenic
982297221 4:153841530-153841552 AATGGGGGTGCCATTTTCAGTGG - Intergenic
982593524 4:157348223-157348245 AAGGTGGCTGCTATTTTCATAGG + Intronic
985441070 4:189982872-189982894 ACGGCGGCTGCCATTTTCCAGGG - Intergenic
999233304 5:150075440-150075462 ACTGTGCTTGCCATGTTCAGGGG - Intronic
1003097468 6:3154245-3154267 ACGGTGGCTGCCATCTTCCGGGG - Exonic
1003107008 6:3225133-3225155 ACGGTGGCTGCCATCTTCCGGGG - Exonic
1006918017 6:37608500-37608522 AAGATGGCTGCCATTATCATGGG - Intergenic
1008471477 6:51889866-51889888 GCAGTGGCTTCCATTTGCAGTGG - Intronic
1016377357 6:143436306-143436328 ACAGAGGCTGCCATTTTCAGGGG + Intronic
1016633496 6:146259468-146259490 ATGGTGGCTGCCACTGCCAGCGG - Intronic
1016789427 6:148052361-148052383 ATGGTGGCTGACATTCTCAGGGG + Intergenic
1018357127 6:163029447-163029469 TCTGTGGCAGACATTTTCAGTGG + Intronic
1018838887 6:167505200-167505222 ACGGTGTCGGCCAATGTCAGAGG + Intergenic
1019220717 6:170470466-170470488 AGGGTGACTGCCATTTTCCAAGG - Intergenic
1019911935 7:4106050-4106072 ACCTTGGCTGCCACCTTCAGTGG + Intronic
1021183444 7:17534905-17534927 AATGTGTCTGCCATTTTCTGAGG - Intergenic
1021210507 7:17846594-17846616 AAGTAGGCTGCCATATTCAGAGG + Intronic
1024713559 7:52046298-52046320 ATGGTGGCTGCCATTTTGGGAGG + Intergenic
1025934449 7:66023692-66023714 ACGGTGGCTGCCAGGGACAGAGG + Intergenic
1026010687 7:66633356-66633378 ATGTTGGCAGCCATGTTCAGTGG + Exonic
1029163302 7:98568418-98568440 ACTGCGGCTCCCATTGTCAGGGG - Intergenic
1030742406 7:113125637-113125659 AGAATGTCTGCCATTTTCAGTGG + Intergenic
1039129291 8:34243621-34243643 ATGGTGGTTGCCATTGGCAGGGG - Intergenic
1039965525 8:42281081-42281103 ACAGTGGCTGCCATTTTTCCAGG + Intronic
1044702766 8:94979224-94979246 ATGGTGTGGGCCATTTTCAGAGG + Intronic
1047740201 8:127800572-127800594 AGGGAGGCTGCCATTTTATGAGG - Intergenic
1049182893 8:141231996-141232018 ACTGTTCCTGCCATTTTCACTGG - Intronic
1051353543 9:16220480-16220502 ATGGTGGTTGCCAGGTTCAGAGG + Intronic
1051667168 9:19476327-19476349 AGGCTGTCTCCCATTTTCAGGGG + Intergenic
1051878109 9:21811998-21812020 ATGGTAGCTGCCATGTTCAGGGG - Intronic
1053657453 9:40232944-40232966 ATGGTGGCTAGCACTTTCAGAGG - Intronic
1053907816 9:42862225-42862247 ATGGTGGCTAGCACTTTCAGAGG - Intergenic
1054357920 9:64081446-64081468 ATGGTGGCTAGCACTTTCAGAGG - Intergenic
1054369577 9:64379215-64379237 ATGGTGGCTAGCACTTTCAGAGG - Intronic
1054527142 9:66143284-66143306 ATGGTGGCTAGCACTTTCAGAGG + Intronic
1054677204 9:67868968-67868990 ATGGTGGCTAGCACTTTCAGAGG - Intronic
1055167401 9:73213531-73213553 ACGTTGGCAGCCATATTCTGTGG + Intergenic
1059695898 9:116730183-116730205 AATGTGCCTGCCATTTGCAGAGG - Intronic
1060735116 9:126061789-126061811 CCAGTGGCTGCCACTCTCAGAGG - Intergenic
1062584533 9:137243152-137243174 ACGGTTGCCGCCGTGTTCAGGGG + Exonic
1062741321 9:138176863-138176885 ACGGCGGCTGCCATTTTCCAGGG + Intergenic
1203560540 Un_KI270744v1:52072-52094 ATGGTGGCTAGCACTTTCAGAGG + Intergenic
1186405996 X:9303531-9303553 ACGCTGGCTGCCATGTTGTGAGG + Intergenic
1186455879 X:9709478-9709500 AGGGAGGCTGCGATTCTCAGTGG - Intronic
1188175633 X:26985368-26985390 AATGTGGCAGCCAGTTTCAGTGG + Intergenic
1190187216 X:48245749-48245771 AGGGTAGCAGCCGTTTTCAGTGG + Intronic
1190656110 X:52613529-52613551 AGTGTAGCAGCCATTTTCAGTGG + Intergenic
1194472916 X:94319635-94319657 AGTGGTGCTGCCATTTTCAGGGG + Intergenic
1195028057 X:100898255-100898277 ATGTAGGCTGCCATTTTCATAGG - Intergenic
1200697619 Y:6374961-6374983 ACGGTGGCTTCTTTTTGCAGAGG + Intergenic
1201036493 Y:9789738-9789760 ACGGTGGCTTCTTTTTGCAGAGG - Intergenic
1201758864 Y:17517211-17517233 ATGGTGGCTGCCATTTTCAGGGG - Intergenic
1201842691 Y:18388779-18388801 ATGGTGGCTGCCATTTTCAGGGG + Intergenic