ID: 1152956858

View in Genome Browser
Species Human (GRCh38)
Location 18:47855-47877
Sequence GGTGAGCTCAGCCACAGTCA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 266
Summary {0: 6, 1: 1, 2: 3, 3: 35, 4: 221}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152956855_1152956858 8 Left 1152956855 18:47824-47846 CCATCATGTTCTTAGCATCAAAC 0: 7
1: 6
2: 9
3: 14
4: 129
Right 1152956858 18:47855-47877 GGTGAGCTCAGCCACAGTCAAGG 0: 6
1: 1
2: 3
3: 35
4: 221
1152956854_1152956858 30 Left 1152956854 18:47802-47824 CCGTGACGGGGGTCACAGGCAGC 0: 4
1: 6
2: 6
3: 10
4: 148
Right 1152956858 18:47855-47877 GGTGAGCTCAGCCACAGTCAAGG 0: 6
1: 1
2: 3
3: 35
4: 221

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152956858 Original CRISPR GGTGAGCTCAGCCACAGTCA AGG Exonic
900083106 1:873862-873884 GGTGAGCTCAGCCACAGTCAAGG - Intergenic
900211968 1:1460590-1460612 GGAGAACGCAGCCACAGCCATGG - Intronic
901956452 1:12789064-12789086 GGTGAGCTCAGCACCAATAATGG - Intergenic
901964526 1:12855514-12855536 GGTGAGCTCAGCACCAATAATGG - Intronic
903416131 1:23184445-23184467 GGTGAATTCTGCCTCAGTCAAGG - Intergenic
904434336 1:30484554-30484576 GCTGAGCTCACCCACAGCCATGG + Intergenic
904935367 1:34126309-34126331 GGTGGGCTCAGCCAGAGTCCAGG - Intronic
905464983 1:38146361-38146383 GGTGAGCACAGCTACCGTAATGG + Intergenic
907167231 1:52424326-52424348 GAAGAGCTCAACCACAGTCAAGG + Intronic
907801048 1:57766050-57766072 GGTGATCTCAGCCACTTTTATGG + Intronic
913206234 1:116541833-116541855 GGTGAGCTCATCCCATGTCAGGG - Intronic
913611185 1:120511215-120511237 GGTGAGAACAGCCTCAGACAAGG - Intergenic
914445138 1:147743922-147743944 GGTCAGATCAGCCTCAGTAAAGG + Intergenic
914580006 1:149011024-149011046 GGTGAGAACAGCCTCAGACAAGG + Intronic
915225949 1:154411483-154411505 GGGGACCTCAGCCACTCTCAGGG - Intronic
915229159 1:154432992-154433014 GGTGAGCTCAGCCTCTGCCTTGG + Intronic
915339323 1:155167581-155167603 GGTGAGCACAGACACAGCCTAGG - Intergenic
920313084 1:205059743-205059765 GGTGAGGGCAGGCAGAGTCAGGG + Intronic
920725729 1:208433206-208433228 TGTGACCTCAGCCACAATGAAGG + Intergenic
921257648 1:213356966-213356988 GGTGACCACAGTCAGAGTCACGG - Intergenic
922341891 1:224664047-224664069 GGTGATGTCAGCCAGAGTGATGG + Intronic
922668738 1:227493427-227493449 GGTGAACTCAGCCATGGTCAGGG + Intergenic
922670858 1:227507872-227507894 GGTGAACTCAGCCATGGTCAGGG - Intergenic
922862935 1:228834825-228834847 GGTAAGCACAGCCACAGTGAAGG + Intergenic
923633534 1:235672279-235672301 GGTGATCTTATCCAAAGTCATGG - Intronic
924243293 1:242059801-242059823 GATAAGCTCAGCCACCGTCAGGG - Intergenic
1062761716 10:27759-27781 GGTGAGCTCAGCCATGGCCTTGG + Intergenic
1062763951 10:47522-47544 GGTAAGCTCAGCCACAGTCAAGG + Exonic
1063394823 10:5677115-5677137 GCTGTGCTCAGCCACTGTCTGGG + Intergenic
1065835874 10:29657763-29657785 GGAGAGCTGAGCCACTGTGATGG - Intronic
1067053586 10:43038862-43038884 AGAGAGCTCAGACTCAGTCATGG + Intergenic
1067660577 10:48233927-48233949 GGTGGGGACAGCCACTGTCATGG - Intronic
1067776844 10:49170413-49170435 GGTGAGCTGAACCTCAGCCAGGG - Intronic
1070552024 10:77497415-77497437 TGTGAGCTCACCCACCCTCAAGG - Intronic
1070851271 10:79563213-79563235 GGGCAGCTCAGCCACATTAAGGG + Intergenic
1071822383 10:89291659-89291681 GGGGAGCCAACCCACAGTCAAGG - Intronic
1073455166 10:103632330-103632352 GGGGAGCTGAGCCACATCCAGGG + Intronic
1073898891 10:108195913-108195935 TGTGAGGTCAGGCACAGACATGG + Intergenic
1075648523 10:124112241-124112263 TGTGAGCTCAGGAAAAGTCAGGG + Intergenic
1076216290 10:128696206-128696228 GGCCAGCCCAGCCACAGGCACGG + Intergenic
1076897487 10:133320033-133320055 GGTGAGCTCTGCCCCAGGGACGG - Intronic
1077633023 11:3823903-3823925 GGTGAGCTCAGCCATCGGCGGGG + Exonic
1080971117 11:37278548-37278570 GGTGGGCTCAGCCACGGACATGG - Intergenic
1081806726 11:45894920-45894942 GGTGACATCAGCCACATGCAAGG + Intronic
1083275237 11:61593357-61593379 GGTGAGCTCACCCAGTCTCATGG - Intergenic
1083430575 11:62612098-62612120 GGTGAGCAGAGTCACAGTGAAGG + Intronic
1083552331 11:63599246-63599268 GGAGTCTTCAGCCACAGTCAGGG + Intronic
1084956626 11:72695065-72695087 GGTGAGCTCCTCAGCAGTCATGG + Exonic
1085297295 11:75438381-75438403 GGTCTGCTCAGACACAGCCAGGG - Intronic
1085546449 11:77322727-77322749 GATCAGCTGAGCCAAAGTCATGG + Intronic
1085733849 11:79022037-79022059 GGTGAGATAACCCATAGTCATGG + Intronic
1086161603 11:83727939-83727961 GGAGAGTTCAGCCAAATTCATGG + Intronic
1088905740 11:114154373-114154395 GGTGAACTCGCACACAGTCATGG - Intronic
1091697810 12:2639835-2639857 GGTGAGCTCCACCAAAGCCAAGG - Intronic
1091848612 12:3677547-3677569 GGTGAGCTGAGGCACCGTAACGG - Intronic
1094813790 12:34165232-34165254 GGTAAGCTCAGCCACGGGCAGGG + Intergenic
1095353523 12:41243975-41243997 GGTGATCTCAGCCAGATCCAAGG + Intronic
1097250671 12:57630936-57630958 GATGACCTCAGCCACAGTGGGGG - Intronic
1097406190 12:59193652-59193674 GATGACTTCAGCCCCAGTCACGG + Intergenic
1097935912 12:65250863-65250885 GGTCATCTAACCCACAGTCATGG - Intergenic
1098588204 12:72180861-72180883 GGTCAGCTCTTCTACAGTCAGGG - Intronic
1099977222 12:89558571-89558593 TGTGATCCCAGCTACAGTCATGG - Intergenic
1100468030 12:94865617-94865639 GGTGTACTCAGCCACTGCCAGGG + Intergenic
1101851461 12:108406052-108406074 GGTAACCATAGCCACAGTCAGGG + Intergenic
1102291032 12:111699867-111699889 GGGGAGCTGTGGCACAGTCATGG - Intronic
1102496101 12:113320559-113320581 GGTGAGAGCAGCCCCAGTGAGGG - Exonic
1102567419 12:113805605-113805627 GGTGAGCTCAGCCTCACCCATGG - Intergenic
1102851850 12:116254040-116254062 TGTGAGCCCAGCCACTTTCACGG + Intronic
1104705457 12:130942496-130942518 TCTGAACTCAGCCAAAGTCATGG - Intergenic
1105287692 13:19019504-19019526 GCTGGGCTAAGCAACAGTCAAGG + Intergenic
1107135351 13:36938318-36938340 GGTGAGGTCAGCAACATTGAGGG + Intergenic
1107393779 13:39994976-39994998 GGAGAGCTTTGCCAAAGTCACGG - Intergenic
1107818589 13:44266372-44266394 GGTGGGCTCACACACAGTCAGGG + Intergenic
1110334283 13:74308730-74308752 GGTGATCTCATCCACATTCATGG - Intergenic
1110933210 13:81249307-81249329 GTTAAGTTCAGCTACAGTCATGG - Intergenic
1113733030 13:112656129-112656151 GGTCAGCTCAGCCACCGGCCTGG - Intronic
1114263674 14:21058203-21058225 GGTGAGCTCACCCATGGTCAGGG - Exonic
1114616030 14:24068915-24068937 TGTGAGCTCAGCCTCAGCCGGGG - Exonic
1114650479 14:24281379-24281401 TGTGAGTTCAGCCACACTCTGGG + Intergenic
1116307359 14:43275202-43275224 AGTGAGTTCAGCCACGGTCAGGG - Intergenic
1118063790 14:62168540-62168562 GATCAGCTGTGCCACAGTCAGGG - Intergenic
1118843513 14:69529110-69529132 GGTGAGCTCACTCACAGCCTTGG + Exonic
1120107653 14:80515282-80515304 GGTGAGCTCTGCCCCAGCCCAGG + Intronic
1121739534 14:96241693-96241715 GGTGAACTCACGCACAGCCAAGG + Exonic
1122371390 14:101230616-101230638 GGTCAGCTCAGCCTCAGAAAGGG - Intergenic
1122631812 14:103110718-103110740 GGTGGGGGCAGCCACAGGCATGG - Intergenic
1123109508 14:105859227-105859249 GGTTAGCTCAGCCCCAGTCCAGG + Intergenic
1123109595 14:105859668-105859690 GGTTAGCTCAGCCCCAGCCCAGG + Intergenic
1123109606 14:105859719-105859741 GGTTAGCTCAGCCCCAGTCCAGG + Intergenic
1126070533 15:44861713-44861735 TCTGAGCCCAGCCACAGTCCTGG - Intergenic
1127789087 15:62382268-62382290 GGTGAGCACAACTACAGTTATGG - Intergenic
1128299555 15:66557387-66557409 AGAGAGGTCAGACACAGTCATGG - Intronic
1128390829 15:67181343-67181365 GGTGAAGCCATCCACAGTCATGG - Exonic
1129505141 15:76075204-76075226 GGTGAGCTCATTCAATGTCATGG - Intronic
1130166870 15:81470586-81470608 AGTCAGCTCAGCCACAGGCTTGG - Intergenic
1130195545 15:81777374-81777396 GGTGAGCACAGATACAGGCAAGG - Intergenic
1130664983 15:85861925-85861947 TCTTAGCTGAGCCACAGTCAGGG - Intergenic
1130834263 15:87633738-87633760 GGGAAGCTCAGCCACAGAAAGGG - Intergenic
1131050890 15:89347127-89347149 GGTGAGAGCTGCCACAGCCAGGG - Intergenic
1131603319 15:93872531-93872553 GGTGAGCTCATTTACACTCATGG + Intergenic
1133094367 16:3431398-3431420 GGTGAGCTTAGCCACTTCCATGG - Intronic
1133825006 16:9270538-9270560 GGTGAGCTCTCTCACAGACACGG - Intergenic
1139430919 16:66910670-66910692 AGTGAGCTCCGCCAAAGTCAGGG - Intronic
1140982143 16:80120873-80120895 GGTGATGTCTGCCACAGTCATGG + Intergenic
1142414756 16:89935299-89935321 GGTGAGCTCGGGCACGGTCAGGG - Exonic
1142440697 16:90095705-90095727 GGTGAGCTCAGCCACAGTCAAGG - Intergenic
1143153704 17:4822731-4822753 GGTGAGCTCAGACCGAGCCAAGG - Exonic
1144071294 17:11673338-11673360 GGACAGCTTATCCACAGTCATGG - Intronic
1144584422 17:16479498-16479520 GTTGGGCACAGCCAGAGTCAAGG - Intronic
1145253369 17:21308996-21309018 GCTGAGCCCAGCCACAGTGGTGG - Intronic
1147335849 17:39726682-39726704 GGTGCTCTTAGCCACAGGCAGGG - Intronic
1148575919 17:48711181-48711203 GGTGTGCTTAGGCACAGTAAAGG - Intergenic
1148694176 17:49549227-49549249 GGAGGGGGCAGCCACAGTCAGGG + Intergenic
1149567850 17:57652350-57652372 AGTGGGGTCAGTCACAGTCATGG + Intronic
1149709390 17:58726743-58726765 GATGAGATCAGGCACATTCAGGG + Intronic
1150834834 17:68554897-68554919 GGTGATCTGAACCAGAGTCAAGG - Intronic
1152424637 17:80212295-80212317 GCAGAGCTCAGCCGCAGACACGG + Intronic
1152954623 18:28089-28111 GGTGAGCTCAGCCATGGCCTTGG + Intergenic
1152956858 18:47855-47877 GGTGAGCTCAGCCACAGTCAAGG + Exonic
1154017973 18:10637358-10637380 TGTGTCCTCAGGCACAGTCATGG - Intergenic
1154204505 18:12325637-12325659 GGTGAGCTCGGGCACGGTCAGGG - Exonic
1155121800 18:22828404-22828426 GGTGATCTCATCTAGAGTCATGG + Intronic
1156990517 18:43402457-43402479 GGTGTGCTTAGCTACAGTAATGG - Intergenic
1160451281 18:78967661-78967683 GCTGGGCTGACCCACAGTCATGG + Intergenic
1161040988 19:2110685-2110707 GGTGAGCCCTGCCCCACTCACGG - Exonic
1161815207 19:6495629-6495651 GGTGAGCTCGGGCACCGTCAGGG + Exonic
1163818618 19:19483257-19483279 GGTGAGCACTGCCACAGTGCTGG - Intronic
1163830085 19:19543454-19543476 GTTGAGCTTAGCTACAGTCCGGG - Intronic
1165170259 19:33887434-33887456 GCTCAGCTCAGCCAGGGTCATGG - Intergenic
1165801240 19:38551819-38551841 GGAGGGCTCAGGCACAGTGAAGG - Intronic
1167232450 19:48293613-48293635 GGCGAGCCCAGCCCCAGTCCAGG + Intergenic
1168453376 19:56483940-56483962 GGACAGCTCATCCACAGTAATGG - Intergenic
926171960 2:10558187-10558209 GGTGATCTGAGCCTCAGCCAGGG - Intergenic
927251964 2:21003966-21003988 GGCAAGCTCAGCCATAGGCAGGG - Intronic
927429499 2:23015229-23015251 GGTCAGCTCAGCCAAGGGCAGGG - Intergenic
931146979 2:59529884-59529906 TGGCAGCTCAGCCACAGCCAGGG + Intergenic
931302932 2:60998768-60998790 TGTGAGATCAGGCACATTCAGGG - Intronic
937478503 2:122236310-122236332 GGTGAGCACACACACCGTCACGG + Intergenic
942314062 2:174682477-174682499 GGTGAGCTCAGCCCGAGGCGCGG + Intronic
945026073 2:205621079-205621101 GGTAAGCCCATCCACAGCCAAGG + Intergenic
948455924 2:238104602-238104624 GATGGGCTCAGCCATAGGCAGGG + Intronic
948794921 2:240397579-240397601 TGTGAGCTCTGGCACAGTCCAGG + Intergenic
1168741094 20:192099-192121 GGTGAGGTCAGGATCAGTCAAGG + Intergenic
1169068298 20:2706792-2706814 GCTGACATCAGCCACAGCCACGG + Intronic
1171052330 20:21871538-21871560 GGTGAGGCCAGCCACAATCAGGG - Intergenic
1171181971 20:23097756-23097778 GGGGAGCTCAGCCACAGGCCAGG + Intergenic
1171482033 20:25461258-25461280 GGAGGGCTCACCCACAGGCATGG + Intronic
1173385911 20:42587665-42587687 GCTGGGCTCAGTCACAGCCAAGG - Intronic
1175446580 20:59024275-59024297 GGTGAGCTCGGCCACGGAGAGGG - Exonic
1178281937 21:31291181-31291203 GGTGATTTCAGACACAGCCAGGG + Intronic
1179719252 21:43306138-43306160 GGTGAGCCCACCCACAGCAAGGG + Intergenic
1181649235 22:24249551-24249573 TGTGATCAGAGCCACAGTCAGGG - Intergenic
1183438678 22:37810237-37810259 GCTCAGCTCAGCCACAGCCCTGG + Intronic
1183828324 22:40405284-40405306 GGTGAGCACAGCCCCAGAAAGGG + Exonic
1185225494 22:49649471-49649493 GGTGACCCCAGGCACAGCCAGGG + Intronic
950050223 3:9982833-9982855 GGAGAGCACTGGCACAGTCAAGG - Intronic
954594910 3:51815946-51815968 AGGGAGTTCAGCCACAGTGAGGG + Intergenic
955988704 3:64602042-64602064 GCTGAGCTAAGCCACTGTCTGGG + Exonic
956024056 3:64963195-64963217 GGTGAGATCACCCACAGAGAAGG - Intergenic
957420004 3:79955203-79955225 GGAGATCTAAGCCATAGTCAGGG + Intergenic
959165412 3:102771417-102771439 TGAAAGCTCAGCCTCAGTCAAGG + Intergenic
959893147 3:111579206-111579228 GAGGAGCTCCACCACAGTCAAGG + Exonic
960007829 3:112799052-112799074 TGGGAGCTCAGTCACAGCCATGG - Intronic
960399548 3:117179641-117179663 GGTGAGCTCATCCAGTTTCATGG + Intergenic
961150163 3:124631223-124631245 GGTGAGATCAGCGAGAGGCATGG - Intronic
962192728 3:133328373-133328395 GGTGAGATCAGGCACATTCAGGG + Intronic
962195676 3:133361295-133361317 GCAGAGCTGAGCCACAGTCCAGG - Intronic
963358126 3:144236181-144236203 AGCGAGCTCAGGAACAGTCAAGG - Intergenic
965769045 3:172161652-172161674 GGTGATCACTACCACAGTCAAGG - Intronic
966370291 3:179244592-179244614 GGTGTGCACTGCCACGGTCAGGG - Exonic
966913619 3:184572994-184573016 GGTGGGCTCCGCCCCAGTGAGGG - Exonic
966975814 3:185082379-185082401 GTTTAGCTCAGCCCCAGTCACGG + Exonic
967326365 3:188244346-188244368 GGTAAGCTCATTCACAGACATGG + Intronic
968357454 3:198120292-198120314 GGTGAGCTCAGCCACAGTCAAGG - Intergenic
968712117 4:2126806-2126828 GGTGAGCTCAGGCCTAGCCAGGG + Intronic
969119834 4:4899999-4900021 GGTGAGCTCAGGTGCAGTGAGGG - Intergenic
969591716 4:8126037-8126059 GGTGAGGTCAGGCAGAATCAGGG + Intronic
970715812 4:18921316-18921338 GTTCAGCTCAGCCACTGTCTGGG - Intergenic
971528179 4:27649269-27649291 GTTGAGTTCAGCCCCAGCCATGG - Intergenic
972719345 4:41680302-41680324 GGTGTGTTGAGTCACAGTCAAGG + Intronic
978735346 4:112077924-112077946 GGTGAGCTCAGCCACCATCAAGG - Intergenic
980092279 4:128455317-128455339 GCTGGGCTCAGCAACAGTCTAGG + Intergenic
980146144 4:128986615-128986637 GACGAGCTCAGCCACAGTAAAGG + Intronic
982167451 4:152627621-152627643 AGTGAGATCTGCCACAGGCACGG + Exonic
982725921 4:158906234-158906256 GGTGAGCTGAGCCACAGGTGAGG - Exonic
985441086 4:189982958-189982980 GGTGAGCTCAGCCACAGTCAAGG + Intergenic
985620415 5:952098-952120 GTGTAGCTCAGCCCCAGTCACGG - Intergenic
985716639 5:1466804-1466826 GGTGAGCTCTGCCACCCCCAGGG + Exonic
987522927 5:19011106-19011128 GATGAGCTGACACACAGTCAGGG + Intergenic
987807495 5:22787974-22787996 AGTAAGTTCAGCCACACTCAAGG + Intronic
992028024 5:72690582-72690604 GGTTAGCAGAGCCACAGTCTTGG - Intergenic
993502677 5:88680446-88680468 GGTGAGCACGGGCACAGTCCCGG + Intergenic
993953406 5:94202468-94202490 GGTGATCTCTGCCAATGTCAGGG + Intronic
995084220 5:108088798-108088820 GGTGTTCTCAGCCATACTCATGG + Intronic
997660579 5:135586515-135586537 AGTGATCTCAGACACAGACATGG + Intergenic
997795900 5:136810625-136810647 TGTGAGCACAGCCTTAGTCAGGG + Intergenic
997826954 5:137114946-137114968 AGGGAGCTTAGCCAAAGTCAAGG + Intronic
998048708 5:139012345-139012367 GATGAGATCAGGCACATTCAGGG - Intronic
998173814 5:139887960-139887982 GGTGGGCTCAGGCCCAATCACGG + Intronic
1003646152 6:7914364-7914386 GGTGATCTCATCCATAGCCATGG + Intronic
1003939696 6:11011920-11011942 GCTCAGCTCACACACAGTCAGGG - Intronic
1004031921 6:11879028-11879050 GGAGGGATCAGCCACATTCAAGG - Intergenic
1004246505 6:13982620-13982642 AGTGGGCACAGCCACTGTCATGG + Intergenic
1004662395 6:17721866-17721888 GATGAGATCAGGCACATTCAGGG + Intergenic
1006002705 6:30978119-30978141 CATGAGCTGAGCCACAGCCATGG + Intergenic
1006141860 6:31934059-31934081 GGTGGGCTCAGCCACTGAAAGGG + Intronic
1006328309 6:33371021-33371043 GGGGTGCACTGCCACAGTCAAGG - Intergenic
1011628523 6:89302611-89302633 GGTGAGCTCGGGCACGGTCAGGG - Intronic
1013618499 6:111867114-111867136 GGTGACCTCACCCACATCCATGG + Intronic
1014097682 6:117478521-117478543 GCTGAGCTCTGCCACAGGGAGGG + Intronic
1015433614 6:133159593-133159615 AATGAGCTCAGTCACAGTCATGG - Intergenic
1015787340 6:136931347-136931369 GGTTAGTTCAGTGACAGTCATGG + Intergenic
1015825436 6:137306025-137306047 GATGAGATCAGGCACATTCAGGG - Intergenic
1016377340 6:143436220-143436242 GGGGAGTTCAGCCACTGTCAGGG - Intronic
1017290943 6:152735800-152735822 GATGAGATCAGGCACACTCAGGG + Intergenic
1017304310 6:152898825-152898847 GGTGAGCTCAGGCACTATGAGGG - Intergenic
1018640952 6:165903702-165903724 GGTGATCTCATCCAAAGTAATGG - Intronic
1018724042 6:166597013-166597035 TGTGATGTCAGGCACAGTCATGG + Intronic
1020119460 7:5495048-5495070 GGTCAGCTCTGCCACCGTCCTGG - Intronic
1020801517 7:12738433-12738455 GGTGAGCTCATCCAATCTCACGG + Intergenic
1023310114 7:38877884-38877906 GGCAAGCTCAGCCCCAGTCTTGG - Intronic
1023818978 7:43969868-43969890 GGTCAGCTCAGCCAGGGACACGG + Intergenic
1024318825 7:48045400-48045422 GAGCAGCTCAGCCACACTCATGG + Intronic
1027426091 7:78062671-78062693 GGAGAGCTCAGCCCCACTTATGG + Intronic
1028984997 7:97002646-97002668 TCTGAGCTCAGAGACAGTCAGGG - Intergenic
1029127745 7:98306412-98306434 GGAGAGCTCAGCCACGTTCAGGG + Intronic
1031425673 7:121602648-121602670 GGTGAAGTCAGGCAAAGTCATGG + Intergenic
1032694665 7:134324697-134324719 CAGGAGCTCACCCACAGTCATGG - Intergenic
1034096899 7:148417452-148417474 GTTGAGCTCAGGCACTGTCATGG + Exonic
1034476671 7:151288552-151288574 GGTGAGCTCACCCAGTCTCATGG - Intergenic
1035640620 8:1182306-1182328 TGTGAGCACTGCCACAGTCAAGG - Intergenic
1035659103 8:1333485-1333507 TGTGAGCTCTTCCACAGACAGGG + Intergenic
1036132874 8:6132776-6132798 TGTGACCTCAGTCTCAGTCAAGG + Intergenic
1036716061 8:11125192-11125214 GGTGAGCAGGGCCAGAGTCATGG - Intronic
1038323137 8:26547859-26547881 GGTCAGATCAGCCACATTGAAGG - Intronic
1041026168 8:53689094-53689116 GGCGGGCTCATCCCCAGTCACGG + Intergenic
1041749424 8:61243524-61243546 TGTGAGGGCAGTCACAGTCACGG - Intronic
1042537183 8:69870660-69870682 GGTGAGCTCTGCCTAAATCAGGG + Intergenic
1045553511 8:103193527-103193549 GGTGAGCTGACACACGGTCAGGG - Intronic
1046204726 8:110978455-110978477 GAAGAGATCAGGCACAGTCAGGG + Intergenic
1046640691 8:116727185-116727207 GGTCAGCTCAGCCACACGGATGG + Intronic
1049882489 8:145075792-145075814 GGTGAGCTCAGCCATGGCCTTGG - Intergenic
1053201057 9:36151778-36151800 GGTGAGCCCAGCAAAAGGCAGGG - Intronic
1055274846 9:74603280-74603302 AGTGAGCTCAGCCACAGGACGGG + Intronic
1055395108 9:75865791-75865813 GGTGAGATCAGTTACAGTAAGGG + Intergenic
1056784565 9:89580985-89581007 GGGGAGCTTAGGCAGAGTCAGGG - Intergenic
1058818494 9:108707285-108707307 CGTGTCCTTAGCCACAGTCAAGG - Intergenic
1060713736 9:125899483-125899505 AGAGAGCTCACCCACAGGCAGGG + Intronic
1061183859 9:129040641-129040663 GGGGATCTCGGCCACCGTCATGG - Exonic
1062348650 9:136127950-136127972 GGTGGGCTCAGGTACAGTCAAGG - Intergenic
1062573010 9:137194206-137194228 GGTGGGCCTAGCCACAGGCAGGG - Intronic
1062741304 9:138176777-138176799 GGTGAGCTCAGCCACAGTCAAGG - Intergenic
1062743727 9:138197185-138197207 GGTGAGCTCAGCCATGGCCTTGG - Intergenic
1186401100 X:9260804-9260826 GGTGATCTCAGCCACATCCAAGG - Intergenic
1186549901 X:10492737-10492759 TGTATCCTCAGCCACAGTCATGG + Intronic
1188948222 X:36334963-36334985 GGTGATCTCATCCAGACTCATGG + Intronic
1189747657 X:44186610-44186632 GGTGAGCTCTGTGACAATCAGGG + Intronic
1190873276 X:54442550-54442572 GGAGAGCTCATCCACACTCTTGG - Intronic
1195058027 X:101165612-101165634 GGTGATCTCATCCAAAGTCATGG - Intergenic
1197183553 X:123562489-123562511 TGTGAGCTCAGGCACCCTCAGGG - Intergenic
1198111937 X:133509631-133509653 GGTGAGCTCATCCACTCCCACGG - Intergenic
1199313352 X:146347459-146347481 GGTGAAGTCACCCACACTCATGG - Intergenic
1199653532 X:149971923-149971945 TGAGAGATCAGCCCCAGTCAGGG + Intergenic
1199692613 X:150320219-150320241 TGTCTGCTCAGCCACAGTCTGGG + Intergenic
1201758876 Y:17517290-17517312 AGTAAGCTCAGCCACAGTCAGGG + Intergenic
1201842679 Y:18388700-18388722 AGTAAGCTCAGCCACAGTCAGGG - Intergenic