ID: 1152960659

View in Genome Browser
Species Human (GRCh38)
Location 18:78625-78647
Sequence GAGCCTAAGAACATGTAGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152960656_1152960659 2 Left 1152960656 18:78600-78622 CCTTGTATCAACTTCTGTTTCAT No data
Right 1152960659 18:78625-78647 GAGCCTAAGAACATGTAGTCAGG No data
1152960654_1152960659 25 Left 1152960654 18:78577-78599 CCTTGTCTGGGAAACTTGCTTGG No data
Right 1152960659 18:78625-78647 GAGCCTAAGAACATGTAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152960659 Original CRISPR GAGCCTAAGAACATGTAGTC AGG Intergenic
No off target data available for this crispr