ID: 1152962135

View in Genome Browser
Species Human (GRCh38)
Location 18:86384-86406
Sequence CTTCATCAGGTGAGGGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152962135_1152962151 13 Left 1152962135 18:86384-86406 CCCTCCACCCTCACCTGATGAAG No data
Right 1152962151 18:86420-86442 TGGAGCCCTGACCCAGCTCTGGG No data
1152962135_1152962147 -7 Left 1152962135 18:86384-86406 CCCTCCACCCTCACCTGATGAAG No data
Right 1152962147 18:86400-86422 GATGAAGGGGAGCCCGGGGCTGG No data
1152962135_1152962152 14 Left 1152962135 18:86384-86406 CCCTCCACCCTCACCTGATGAAG No data
Right 1152962152 18:86421-86443 GGAGCCCTGACCCAGCTCTGGGG No data
1152962135_1152962157 25 Left 1152962135 18:86384-86406 CCCTCCACCCTCACCTGATGAAG No data
Right 1152962157 18:86432-86454 CCAGCTCTGGGGCAGACCAGTGG No data
1152962135_1152962150 12 Left 1152962135 18:86384-86406 CCCTCCACCCTCACCTGATGAAG No data
Right 1152962150 18:86419-86441 CTGGAGCCCTGACCCAGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152962135 Original CRISPR CTTCATCAGGTGAGGGTGGA GGG (reversed) Intergenic
No off target data available for this crispr