ID: 1152976130

View in Genome Browser
Species Human (GRCh38)
Location 18:220511-220533
Sequence TGCTGCTGGTAGGAGTCTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 196}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152976130_1152976134 17 Left 1152976130 18:220511-220533 CCATCAGACTCCTACCAGCAGCA 0: 1
1: 0
2: 0
3: 8
4: 196
Right 1152976134 18:220551-220573 TCCATAATTCTTATAAAATCTGG 0: 1
1: 0
2: 0
3: 22
4: 284
1152976130_1152976136 18 Left 1152976130 18:220511-220533 CCATCAGACTCCTACCAGCAGCA 0: 1
1: 0
2: 0
3: 8
4: 196
Right 1152976136 18:220552-220574 CCATAATTCTTATAAAATCTGGG 0: 1
1: 0
2: 1
3: 75
4: 1194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152976130 Original CRISPR TGCTGCTGGTAGGAGTCTGA TGG (reversed) Intronic
900582548 1:3416242-3416264 TGCTGCTGGTAGGGAGCAGAGGG - Intronic
902120445 1:14160431-14160453 TGCTGCAGGGAGGAGGGTGAGGG + Intergenic
902290706 1:15432816-15432838 TGGTTCTGGTGGGAGCCTGATGG - Intergenic
905240341 1:36576941-36576963 TGCATCTGGTAGTAATCTGAAGG + Intergenic
905453320 1:38071038-38071060 AGCAGCTGGTAGGAGTCTAGAGG - Intergenic
905941590 1:41867511-41867533 TGCAGCTGGAATGAGTCTGGAGG - Intronic
908353275 1:63307215-63307237 TTCTGCTGGTAGAAGTTTCAAGG - Intergenic
912804028 1:112741914-112741936 TGCTGTTTGAAGGACTCTGAAGG + Intergenic
919664394 1:200278409-200278431 TGCTGCTGGCTGGATTATGATGG - Intergenic
919776112 1:201194948-201194970 TGTTCCTGGTGGGAGGCTGAGGG + Intronic
924618860 1:245642270-245642292 TGCTGTGGGAAGGAGGCTGATGG + Intronic
1067080727 10:43210893-43210915 TGCTGCTCCAAGGAGTCAGAGGG - Intronic
1067080741 10:43210957-43210979 TGCTGCTCCAAGGAGTCAGAGGG - Intronic
1069991897 10:72321305-72321327 TGTTTCTGGGAGGGGTCTGAGGG + Intergenic
1070407090 10:76106673-76106695 TGCTCCTTGTAGGAGACGGAAGG + Intronic
1071229228 10:83565287-83565309 GGCGGCAGGCAGGAGTCTGAGGG - Intergenic
1071722047 10:88156815-88156837 TGCAGCTGGGAAGAGTCAGAGGG - Intergenic
1071787817 10:88922126-88922148 TGCTGCTGCTAAGAGCCTGCAGG - Intronic
1074036260 10:109741870-109741892 ACCTGCTGGTAGGATTCTGCAGG - Intergenic
1074360333 10:112820456-112820478 TGCCACTGGTCTGAGTCTGATGG - Intergenic
1074882097 10:117667376-117667398 TGCAGCTTGGAGGAGTCTGTGGG + Intergenic
1077404923 11:2378542-2378564 TGCTGCTGGGAAGTGACTGATGG + Intronic
1077649803 11:3960085-3960107 TGCTGCATGTAGAAGTTTGATGG + Intronic
1077793033 11:5461720-5461742 TCCTGCAGGTAGGATCCTGAAGG + Intronic
1078575904 11:12502457-12502479 TGAAGCTGGTAGGACTGTGAAGG + Intronic
1079026387 11:16951245-16951267 TGCTGCATGGAGGAGGCTGAAGG - Intronic
1080304947 11:30826058-30826080 TGCTGCTGCTCTGAGTCTGGGGG + Intergenic
1081242639 11:40725789-40725811 TGCTGATGCTAGGTTTCTGAAGG - Intronic
1081938314 11:46919377-46919399 TGGGGCTGGAAGGAGGCTGAGGG - Intergenic
1084925936 11:72511243-72511265 TCCTGCTGCTAGGATTCTGGAGG + Intergenic
1085763632 11:79263239-79263261 TGCTCTTGCTAGGAGTCAGACGG - Intronic
1086856954 11:91877000-91877022 TGCTGTTGGTAGGAGTCCATTGG - Intergenic
1087845406 11:102966549-102966571 TTCTCCTGGTAAGGGTCTGAAGG - Intergenic
1088592212 11:111413694-111413716 TGCTGCTGGCATCATTCTGAAGG + Intronic
1089980352 11:122766922-122766944 TCCTGCTGACAGGAGTCTGGGGG + Intronic
1092745066 12:11665495-11665517 TGCTGAGGACAGGAGTCTGATGG + Intronic
1095229768 12:39725856-39725878 GGTAGCTGGTAGGTGTCTGAGGG + Intronic
1098501958 12:71203078-71203100 TGCTGCTGGTAGAATGCTGCTGG + Intronic
1102396807 12:112592922-112592944 TTCTGCTGTATGGAGTCTGAAGG + Intronic
1103918732 12:124388804-124388826 GGCTGCTGGTTGGCGTCTGCTGG + Intronic
1104985800 12:132596329-132596351 CGCTGCTGGAAGGCGTCAGAGGG - Intergenic
1105046254 12:133006247-133006269 TTCTACTTGCAGGAGTCTGAAGG - Intronic
1105296989 13:19096364-19096386 TGCTGTTAGTAGGAGTCTGGGGG - Intergenic
1105998773 13:25699338-25699360 TGCTGCAGGTAGGAACCTGCAGG + Exonic
1106999585 13:35527408-35527430 TGCTGATGGCAGGAGGCAGACGG - Intronic
1109098295 13:58145305-58145327 TGCTGCAGGTGGGACTCTCATGG + Intergenic
1115009373 14:28525666-28525688 TGGTGCTGGTAAGTGTCTGATGG + Intergenic
1115056417 14:29133432-29133454 TGCTGCTGGATGTTGTCTGAAGG + Intergenic
1115206901 14:30917235-30917257 TGATGCTGGTAGGAGGGCGAGGG - Intronic
1115463335 14:33686190-33686212 TGCTGCTGGGATGAGTCTCCTGG - Intronic
1118414087 14:65514145-65514167 TGCTGTTGGTAGGACCCTCAAGG + Intronic
1118414108 14:65514316-65514338 TGCTGCTGGCAGGACCCTCAAGG + Intronic
1120620333 14:86755213-86755235 TGCTGGAGCTTGGAGTCTGAAGG + Intergenic
1121546053 14:94764568-94764590 AGCTGCTGTTAGCAGTCTGCTGG - Intergenic
1121922522 14:97896211-97896233 TGCAGGTGGTATGAGTGTGAGGG - Intergenic
1122721224 14:103723715-103723737 TGCTTCTGGAAGGAGTCCTATGG - Intronic
1123126954 14:105953705-105953727 TCCTGCTGCTAGGATTCTGGAGG - Intergenic
1123407417 15:20029525-20029547 TCCTGCTGCTAGGATTCTGGAGG - Intergenic
1123516744 15:21036181-21036203 TCCTGCTGCTAGGATTCTGGAGG - Intergenic
1124431486 15:29612476-29612498 CTCTGCTGGTAGCAGGCTGAAGG - Intergenic
1125575242 15:40750916-40750938 GGCAGCTGGCAGGAGTCTGGTGG - Intronic
1129744372 15:78007904-78007926 AGGTGCTGGCAGGAGACTGAAGG - Intronic
1131266810 15:90920330-90920352 TGTTTCTCCTAGGAGTCTGAAGG + Exonic
1135711593 16:24721980-24722002 TCCTGGTGGTAGGTGTCTGTGGG + Intergenic
1136000875 16:27291680-27291702 TGCTGCAGATAGGAGACAGAGGG + Intergenic
1136292676 16:29285305-29285327 TGCTGCAGGGAGGCGGCTGAGGG - Intergenic
1137625936 16:49908614-49908636 TGCTTCTTGGAGGAGTTTGAGGG + Intergenic
1137796251 16:51222557-51222579 TGCTGTGGGTAGTAGTCAGATGG + Intergenic
1137937144 16:52645556-52645578 GGCTTTTGGTAGGAGTCTCATGG + Intergenic
1138626375 16:58255191-58255213 AGCTGCTGGTACAAGTCCGAGGG + Intronic
1139364340 16:66424585-66424607 TGCTGGAGGGAAGAGTCTGAGGG - Intergenic
1143239730 17:5433795-5433817 TGCTGCTGGAAGGAGATGGATGG + Intronic
1144146425 17:12403779-12403801 TGCAGCTGGTGGGAGTGTGGGGG - Intergenic
1145777469 17:27539378-27539400 TGCTTCTGCTGGGAGGCTGAGGG - Intronic
1145794846 17:27649628-27649650 TGCTGCTGAGAGGAGTGGGATGG + Intergenic
1145809339 17:27755347-27755369 TGCTGCTGAGAGGAGTGGGATGG + Intergenic
1146234492 17:31145638-31145660 TGCTGTTAGTAGGAGCCTGGGGG + Intronic
1147848071 17:43419279-43419301 TGGTGAGGGTAGGAGACTGAGGG + Intergenic
1147955843 17:44134042-44134064 TGCTGCTGGGAGGGGTAAGAAGG - Intergenic
1149854528 17:60068919-60068941 GGCTGCTTTTAGGAGTTTGAGGG - Intronic
1151455909 17:74225741-74225763 AGGTGCTGGTAGGAGACTGGAGG - Intronic
1151601414 17:75108496-75108518 TGCAGCTGGCTGGAGTGTGACGG + Intergenic
1152976130 18:220511-220533 TGCTGCTGGTAGGAGTCTGATGG - Intronic
1153987354 18:10364996-10365018 TGCTGGTGGCAGGAATCTTAAGG - Intergenic
1154960893 18:21307707-21307729 TGCTACTGGCAGAAGTCAGAGGG - Intronic
1157312955 18:46566132-46566154 TGCTGCTGGTAGGGTCCTGCAGG - Intronic
1157464792 18:47933654-47933676 TGCTTCTGGAAAGAGCCTGAGGG + Intergenic
1159038429 18:63299485-63299507 TACTGCTGGTAGCAGTGTGTTGG - Intronic
1160694847 19:478464-478486 TGTTGCTGGGAGGACGCTGAGGG + Intergenic
1161028189 19:2046268-2046290 TGCAGCTGGTAGACGTCTGCCGG + Exonic
1163222818 19:15934322-15934344 TGCTGCTGGTTGGAGGCTCCTGG - Exonic
1164736997 19:30548941-30548963 AACTGCTTGTAGAAGTCTGATGG - Exonic
1164813578 19:31177110-31177132 TGCTGCTGGGAAAAGTCTGCTGG - Intergenic
1165857327 19:38887578-38887600 TGGGGCTGGTAGGAGGCAGAGGG - Intronic
925927998 2:8684577-8684599 TGCTGCTGGTGGGGGGATGAAGG - Intergenic
927576767 2:24207391-24207413 TGCTGCTGGAAGGAGGCTGGTGG + Intronic
928000438 2:27518930-27518952 TGCTGCAGGTAGGGATATGATGG + Exonic
928077865 2:28281466-28281488 TCCTGCTGGGAGGAGACTGGTGG - Intronic
928834527 2:35528146-35528168 TGCTGCTTTTAGGATTTTGAGGG + Intergenic
932053959 2:68425943-68425965 TGCTGCTGGTGGTGGTCTGTGGG - Intergenic
932756824 2:74415125-74415147 TGCTGCTGGCAGGACGCGGAGGG + Exonic
933984675 2:87580737-87580759 GGCTGCAGGTAGGAGTTTGATGG + Intergenic
936000155 2:108819516-108819538 TTCTGCTGGAAGAGGTCTGAGGG + Intronic
936309176 2:111370063-111370085 GGCTGCAGGTAGGAGTTTGATGG - Intergenic
939409898 2:141811525-141811547 TGCTGCTGGTATCAGGCGGAGGG - Intronic
944090203 2:195900281-195900303 TACTGCTGCTGGGAATCTGAAGG - Exonic
1168960301 20:1864413-1864435 TCCTGCTGCAAGGAGGCTGAGGG + Intergenic
1169468243 20:5860211-5860233 TGCTGCTGTTAGAAAGCTGAAGG - Intronic
1169904450 20:10587415-10587437 TGCTGCTGGTAGGTATCTTCTGG - Intronic
1170906048 20:20515990-20516012 TGCTGCTAGTAGAACACTGAGGG + Intronic
1171256395 20:23691766-23691788 TGCTGGTGGGTGGAGTGTGAGGG + Intergenic
1171263753 20:23753690-23753712 TGCTGGTGGGTGGAGTATGAGGG + Intergenic
1171272921 20:23830360-23830382 TGCTGGTGGGTGGAGTGTGAGGG + Intergenic
1172148660 20:32775362-32775384 TGCTGCTGGTATCAGCCTGGAGG + Intronic
1172968894 20:38859118-38859140 TTCTGATGGCAGGAGTTTGATGG + Intronic
1176658855 21:9614582-9614604 TCCTGCTGCTAGCAGGCTGAGGG - Intergenic
1185151353 22:49165317-49165339 TGCTCCTGGGAGGAGACTGCAGG + Intergenic
949743557 3:7263711-7263733 TCGTGCTGGTAGCAGTGTGACGG + Intronic
949908333 3:8878124-8878146 AGATGCTGGTAGAAGTCTGTCGG + Exonic
949916399 3:8967931-8967953 TGTTGCTGGAAGGAGTCCCATGG - Intergenic
950706573 3:14786068-14786090 ACCTGCTGGCAGGAGTCTGGGGG - Intergenic
951316681 3:21195830-21195852 TGCTGCTGGTCAGAATCTGCAGG - Intergenic
953543028 3:43839597-43839619 TGCTGCTGGAAGGAGTCTCTTGG + Intergenic
954069914 3:48135412-48135434 AGCTGCTGGTGGGAGGCTGGGGG - Intergenic
954393265 3:50278730-50278752 GGCTGTGGGTAGGAGTCTGCAGG + Intergenic
955811758 3:62798342-62798364 TCCTGCTGGAAGGAGGATGAAGG - Intronic
957956790 3:87197502-87197524 TGCTCATGGTAGGGGCCTGAAGG + Intergenic
960845551 3:122001387-122001409 TGCTGCTGATTGGAGTGTGCTGG - Exonic
961431373 3:126886343-126886365 TGCTGTTCTTAGGAGTGTGATGG + Intronic
967635288 3:191793934-191793956 TTCAGCTGGTATGAGTCAGATGG + Intergenic
967873352 3:194250094-194250116 GGCTGCTGGGAGAAGTCTGCTGG - Intergenic
968045210 3:195620090-195620112 TGCTGTTGGTTGTAGTCGGAGGG - Intergenic
968061062 3:195726433-195726455 TGCTGTTGGTTGTAGTCGGAGGG - Exonic
968086581 3:195876685-195876707 TGCTGCTGGTGGGGCTCTGGGGG - Intronic
968637801 4:1691062-1691084 TCCCGCTGGTAGGAACCTGAGGG + Intergenic
969584370 4:8083556-8083578 TACTGCTGATAGGAGAATGAGGG - Intronic
969836971 4:9850218-9850240 TCCTGCTGCTAGGATTCTGGAGG - Intronic
970702119 4:18754388-18754410 TGCTGCTGGCATGGCTCTGAGGG + Intergenic
972199585 4:36698447-36698469 TGCTGCAGGAAGGAGTAAGACGG + Intergenic
974585824 4:63875673-63875695 TGGTGCTGGTGGGAGTGTGGCGG - Intergenic
975033138 4:69648842-69648864 AACTGCTGGTAGCAGTCTTAAGG + Intronic
975209494 4:71682711-71682733 TTCTGCTTGTAGGTTTCTGAGGG + Intergenic
977377300 4:96222191-96222213 GTCTGCTGGTAGGAGGGTGATGG - Intergenic
977772101 4:100871504-100871526 TTCTGCCAGTAGAAGTCTGAGGG - Intronic
981092948 4:140751969-140751991 TGCTGCTGGTGGGAGTATATTGG + Intronic
981155234 4:141427211-141427233 TGTTGCTGGTCTAAGTCTGAGGG - Intergenic
981647836 4:147020122-147020144 TGCTGCTGCTGGGAGGCTGTAGG + Intergenic
984290862 4:177792254-177792276 AGCTTCTGGTAAGAGTCTCAAGG + Intronic
986153992 5:5155615-5155637 AGCTGGTGCTAGGACTCTGAGGG + Intronic
986718492 5:10541040-10541062 GGCTGCTGGTAGGTGAGTGAGGG - Intergenic
988482601 5:31642263-31642285 TGCTGCGGGGATGTGTCTGAGGG - Intronic
991412349 5:66357676-66357698 GGCTGCTGGTAGGAGTCACCAGG - Intergenic
992175905 5:74148440-74148462 TGGTACTGGTGGGAGACTGAAGG + Intergenic
992184542 5:74231573-74231595 TCCTCCAGGTAAGAGTCTGACGG + Intergenic
992794100 5:80239957-80239979 TGCTCCTGTTAGCTGTCTGAGGG - Intronic
997021449 5:130007572-130007594 TCCTGCTGCTAGGATTCTGGAGG - Intronic
997424272 5:133792609-133792631 TGCTCCTAGCAGGGGTCTGAGGG + Intergenic
999881321 5:155867667-155867689 TGCTGCTGCTAGTATTATGAAGG - Intergenic
1000488287 5:161876570-161876592 TGATGCTGCTAGGAGCCCGAAGG - Intronic
1002401106 5:178991983-178992005 TGCGCCTGGTAGGAGTCGGGTGG + Exonic
1002602754 5:180363336-180363358 TGGTGCAGGTAGGAGGCTTAGGG + Intergenic
1004427819 6:15517947-15517969 TGCTGCGGGTATGACTGTGAGGG + Intronic
1006729915 6:36229066-36229088 TGCTGCTGTGAGGGGGCTGAGGG + Intronic
1007758410 6:44116329-44116351 TGTTGCTGTTAGAAGTGTGATGG - Intronic
1011184598 6:84660264-84660286 AGCTTCTGGCAGGACTCTGAAGG + Intergenic
1011755945 6:90498315-90498337 GGCTGCTGGGAGGCTTCTGATGG - Intergenic
1012051998 6:94358580-94358602 TGCTGGTGGCAGGAGGCTGTAGG - Intergenic
1016842749 6:148540883-148540905 TGCTGCTGGTATGACCCTGATGG - Intronic
1017361121 6:153573139-153573161 GCCTGCTGGTAGGGTTCTGAAGG - Intergenic
1017848864 6:158285032-158285054 TGTTGCTGGTATGATTCTCAAGG + Intronic
1019758075 7:2788040-2788062 AGCTGCTCGTGGGAGGCTGAGGG + Intronic
1019849943 7:3544894-3544916 TGCTGCTGATAGCTGTCAGAGGG + Intronic
1020154418 7:5710659-5710681 TACTGGTGCTAGGAGTGTGAAGG - Intronic
1024397765 7:48888807-48888829 TGCTGCTGGCAGGTGGCTGGGGG + Intergenic
1028346997 7:89795396-89795418 AGCTGCTTGCAGTAGTCTGAGGG + Intergenic
1035363505 7:158329428-158329450 TGCTGCTGTTAGCAGGCGGACGG + Intronic
1037177278 8:15962091-15962113 TCCTGCAGGTAGGATTCTGGAGG + Intergenic
1037670843 8:21013891-21013913 TGTTGCAGGGAGGTGTCTGAGGG - Intergenic
1037910112 8:22739242-22739264 TGCTGCATGTAGGAGGCTGCAGG + Intronic
1038167712 8:25101738-25101760 TGCTGCTGGCAGGATGCTAAAGG + Intergenic
1041548811 8:59077622-59077644 CCCTCCTGGTGGGAGTCTGAAGG + Intronic
1041766842 8:61427662-61427684 TCCTCCTGGTAGGATTCTGCAGG - Intronic
1045182033 8:99794631-99794653 TTCTGCTGGTAGAATTTTGAAGG + Intronic
1051225629 9:14896174-14896196 TGGTGCTGGTGGGAGTGGGAGGG - Intronic
1052038620 9:23712064-23712086 TGGTGCTGATAGGAGGCTGTGGG + Intronic
1052584960 9:30415018-30415040 TGCTGTGGGAAGGAGGCTGATGG + Intergenic
1055912772 9:81371265-81371287 TTCAACTGCTAGGAGTCTGAGGG + Intergenic
1056762673 9:89426157-89426179 TGCAGCTGGGCTGAGTCTGAGGG - Intronic
1057577384 9:96254279-96254301 TGCTGTTGGCAGGAGGATGAGGG - Intronic
1057724248 9:97556938-97556960 TGCTGATGGGAGGAGCCTGGAGG + Intronic
1062322530 9:135997367-135997389 TGCTGCAGAGAGGAGCCTGAGGG - Intergenic
1062614229 9:137388780-137388802 TGCTGCTGGCAGGTGTGGGACGG - Intronic
1203636601 Un_KI270750v1:118189-118211 TCCTGCTGCTAGCAGGCTGAGGG - Intergenic
1186504580 X:10080962-10080984 TGGTGCTGGTGTGGGTCTGAAGG + Intronic
1187468149 X:19544001-19544023 TGCTGCTGGAGGGAGCCTCACGG - Intronic
1187614805 X:20981409-20981431 TCCTGCAGCTAGGATTCTGATGG - Intergenic
1190118033 X:47638407-47638429 TGAAGCGGGTAGGAATCTGAGGG + Intronic
1190577900 X:51859959-51859981 TCCTGTGGGTAGGAGTGTGATGG + Intronic
1193968684 X:88022786-88022808 TGCTGCTGGTAAAAATTTGAAGG - Intergenic
1194972721 X:100361999-100362021 TTTTGCTGCTGGGAGTCTGATGG - Intronic
1195564597 X:106326180-106326202 TGAAGCTGGGAGGAGTCTGAGGG - Intergenic
1196192730 X:112811418-112811440 TGGTGATGGTAGGAGGGTGATGG + Intronic
1198841718 X:140864796-140864818 TCCTGCTGCTAGGATTCTGGAGG - Intergenic
1198973862 X:142312785-142312807 TGCTTTTGGAAGGAGTCAGAGGG - Intergenic
1200091977 X:153640227-153640249 TGCTGCTGACGGGAGTCTCAGGG - Intergenic