ID: 1152984685

View in Genome Browser
Species Human (GRCh38)
Location 18:311097-311119
Sequence GGGCCCTGGGAAGACTGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152984685_1152984692 29 Left 1152984685 18:311097-311119 CCTTCACAGTCTTCCCAGGGCCC No data
Right 1152984692 18:311149-311171 TGTATGAAACAAAGCCTTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152984685 Original CRISPR GGGCCCTGGGAAGACTGTGA AGG (reversed) Intergenic
No off target data available for this crispr