ID: 1152985211

View in Genome Browser
Species Human (GRCh38)
Location 18:314721-314743
Sequence ACAATCCCGGCTATGAAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152985206_1152985211 3 Left 1152985206 18:314695-314717 CCTTGGAGGAGGCTGGAGGCTGG No data
Right 1152985211 18:314721-314743 ACAATCCCGGCTATGAAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152985211 Original CRISPR ACAATCCCGGCTATGAAGGC AGG Intergenic
No off target data available for this crispr