ID: 1152986233

View in Genome Browser
Species Human (GRCh38)
Location 18:323950-323972
Sequence CTGGAAAAACAAATGGAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 771
Summary {0: 1, 1: 0, 2: 10, 3: 80, 4: 680}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152986233_1152986238 10 Left 1152986233 18:323950-323972 CCTTTCTCCATTTGTTTTTCCAG 0: 1
1: 0
2: 10
3: 80
4: 680
Right 1152986238 18:323983-324005 TTCTTCACATACAGTACTCAAGG 0: 1
1: 0
2: 0
3: 14
4: 206
1152986233_1152986239 21 Left 1152986233 18:323950-323972 CCTTTCTCCATTTGTTTTTCCAG 0: 1
1: 0
2: 10
3: 80
4: 680
Right 1152986239 18:323994-324016 CAGTACTCAAGGCTTTCCTTAGG 0: 1
1: 0
2: 0
3: 10
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152986233 Original CRISPR CTGGAAAAACAAATGGAGAA AGG (reversed) Intronic
900340125 1:2184559-2184581 TTGGAAAAACAATAGGAGAAGGG - Intronic
902180271 1:14682937-14682959 CTTGAAAAAGAAAAGGAGAGAGG - Intronic
902724491 1:18325746-18325768 CTGGGAAAACAGATGGAGACAGG - Intronic
902794479 1:18792285-18792307 CTGAATATACAAATGGACAATGG + Intergenic
903416489 1:23186889-23186911 CTTAAAAAAAAAATAGAGAAAGG + Intergenic
903522829 1:23965853-23965875 CTTCAAAAGGAAATGGAGAAGGG + Intronic
903852255 1:26315106-26315128 CAGGTAAAATAATTGGAGAAGGG + Intronic
904346518 1:29875543-29875565 CTGAATATACAAATGGACAATGG + Intergenic
904400832 1:30255388-30255410 ATAGAAAAAGAAATGAAGAAAGG + Intergenic
904861014 1:33537610-33537632 CTGGGAAGACGAAGGGAGAAAGG + Intronic
904950341 1:34233224-34233246 CTTGAAAGAGAAATGGAGCAGGG - Intergenic
905757060 1:40519569-40519591 CTGCAAAAAAAAAGAGAGAATGG + Intergenic
906025209 1:42667642-42667664 CTGTAAAAATAAAAAGAGAAAGG + Intronic
906076327 1:43054832-43054854 GTGGATGAATAAATGGAGAAGGG - Intergenic
906541514 1:46590156-46590178 ATTCCAAAACAAATGGAGAACGG + Intronic
906976650 1:50581567-50581589 CTGGGAAGACATATGTAGAATGG + Intronic
907338409 1:53715865-53715887 CTGCAAACAGAAGTGGAGAATGG + Intronic
907398312 1:54207987-54208009 CTGGAAAAACACCTTGAGAATGG - Intronic
907819780 1:57955809-57955831 CTAGAAAAACAAATGCACCAAGG + Intronic
907972575 1:59398014-59398036 CTGGAGAAACAAAATTAGAAGGG - Intronic
908577524 1:65476579-65476601 CTTGAAAAAGAAATGGGTAAAGG - Intronic
908701184 1:66902698-66902720 CTGCAAAAATAAATTCAGAATGG - Intronic
908827606 1:68148663-68148685 GAGGAAAACCAAATTGAGAAGGG + Intronic
909157602 1:72098282-72098304 CTGGAAAAAAAAATTTAAAACGG + Intronic
909508455 1:76422215-76422237 GTGGAAAAACAATTGAATAAAGG + Intronic
910239365 1:85069766-85069788 CTGGGATAGCATATGGAGAAGGG + Intronic
910571827 1:88714041-88714063 CAGAAACAAGAAATGGAGAAAGG - Intronic
911370307 1:96988086-96988108 CTGGGAACACAGATGGGGAAGGG - Intergenic
911509662 1:98795756-98795778 ATGGAAATAAAAATGGACAAAGG - Intergenic
911870610 1:103093434-103093456 CTGGAAAAAAAAATCCACAAAGG + Intronic
911981355 1:104571002-104571024 ATAGAAAAACAAAAGGAGAAAGG + Intergenic
912749992 1:112279504-112279526 ATGGAAGAACACATGGAGAGAGG - Intergenic
912902250 1:113664129-113664151 GTAAAAAGACAAATGGAGAATGG - Intronic
913033709 1:114938726-114938748 CTGGAAAAAAAAATAAAGTATGG + Intronic
913530174 1:119728377-119728399 CTGGAAGGACAGATGGACAATGG - Intronic
913612297 1:120520191-120520213 AGTGAAAAACAATTGGAGAAGGG - Intergenic
913687129 1:121243050-121243072 CTGGAAAAATAACTGTGGAATGG + Intronic
914038987 1:144030688-144030710 CTGGAAAAATAACTGTGGAATGG + Intergenic
914150466 1:145037239-145037261 CTGGAAAAATAACTGTGGAATGG - Intronic
914578892 1:149002047-149002069 AGTGAAAAACAATTGGAGAAGGG + Intronic
914768503 1:150661441-150661463 CTGGATAAACAAATGTGGTATGG + Intronic
915160942 1:153920321-153920343 CTGGCAAAAAAAGGGGAGAAGGG + Intronic
915865949 1:159499568-159499590 TAGGAAGAACAGATGGAGAAAGG - Intergenic
916090445 1:161304864-161304886 CAGGAAAAACAAATGGGAAATGG - Exonic
916556738 1:165899962-165899984 CTGGAAAAGCAAATGGGGAATGG - Intronic
917127086 1:171696572-171696594 CTGGAAAAACAGAGGGTAAAGGG + Intergenic
917211237 1:172633949-172633971 CAGGAAAGACAAATGCAGAGAGG + Intergenic
917219383 1:172711532-172711554 CAGGAAAAACAAAGGAATAAAGG - Intergenic
917636305 1:176940156-176940178 CTGAATATACAAATGGACAATGG + Intronic
917707266 1:177647238-177647260 CAGGACAAACAGATGAAGAAAGG - Intergenic
917915693 1:179699174-179699196 CTGACAAAAGCAATGGAGAAAGG + Intergenic
918484531 1:185015301-185015323 CTGGAAATACAGATGCAGATTGG - Intergenic
918502431 1:185212351-185212373 CAGGAAAAACAGATGGAAGATGG - Intronic
919560587 1:199113954-199113976 ATAGAAAAAGAAATGAAGAAAGG + Intergenic
919828141 1:201518650-201518672 CTGAAAAAACAACTGATGAAAGG + Intergenic
920372288 1:205486737-205486759 CTGGAAGAAGAAATGGAACAAGG - Intergenic
920474457 1:206261571-206261593 CTGGAAAAATAACTGTGGAATGG + Intronic
920493023 1:206433164-206433186 CTGCAAAAAGAAATGCAGGAAGG + Intronic
920742889 1:208598150-208598172 CTGGGAAAAGAGATGGAGGAGGG + Intergenic
921045424 1:211473455-211473477 ATGGAAAAAAAGAAGGAGAAGGG + Intergenic
921413101 1:214857869-214857891 CTGGGAAAAAAAATGTAGAAAGG + Intergenic
922312699 1:224410552-224410574 ATGGGAAAACAAAGGGGGAAAGG + Intronic
922369836 1:224898273-224898295 CTGAATAGACAAATGGACAATGG - Intronic
923236035 1:232034001-232034023 CCAGAAAAAAAAATGCAGAATGG - Intronic
924251266 1:242135562-242135584 CTAGGAAAACAAATGCAGAGAGG + Intronic
924272033 1:242343919-242343941 CTGAATAAACAAATGGACAATGG + Intronic
924652709 1:245944868-245944890 CTGACAAAAGCAATGGAGAAAGG + Intronic
1063480249 10:6369260-6369282 CTAGAAAAATAAATTCAGAAAGG - Intergenic
1064753425 10:18554605-18554627 GTGGAAAAAGGACTGGAGAATGG + Intronic
1064754139 10:18559466-18559488 ATGGAGAATCGAATGGAGAATGG + Intronic
1064755478 10:18568919-18568941 ATGGAGAACCAAATGGAGAATGG - Intronic
1064756096 10:18572887-18572909 ATGGAAAATGGAATGGAGAATGG - Intronic
1064829899 10:19451125-19451147 GTTGAAAAACAAATTCAGAAGGG - Intronic
1065986654 10:30960522-30960544 CTGCTAAGACAAATAGAGAAAGG - Intronic
1066045496 10:31591685-31591707 CAGGATAAAAAAATGAAGAAAGG - Intergenic
1066533770 10:36367987-36368009 CTGGAAATAAAGATGAAGAAGGG + Intergenic
1066699329 10:38110217-38110239 CTGAAAAAAGCAATGGGGAAAGG + Intronic
1066712636 10:38252211-38252233 CTGAATAAACAAATGGACAATGG - Intergenic
1066985071 10:42457954-42457976 AAGGAAGAACAAATGCAGAAGGG + Intergenic
1067222297 10:44352942-44352964 CTGGTGACACAGATGGAGAAAGG + Intergenic
1067772643 10:49138439-49138461 CTGGAAAACCCACTGGAGAGTGG - Intergenic
1068345619 10:55774519-55774541 CTGACAAAAGAAATGGGGAAAGG + Intergenic
1068690531 10:59909140-59909162 CTGCAAAAACACATGAACAAAGG + Intergenic
1068752051 10:60605687-60605709 ATGGAAAAATCAATGGACAAAGG + Intronic
1068979036 10:63041941-63041963 CAGGAAAAACAAATGAATATTGG + Intergenic
1069178051 10:65319646-65319668 GTGGAAAATCAAAGGCAGAAGGG - Intergenic
1069961249 10:72080695-72080717 CTGGATAAACAGAAGGAGACAGG + Intronic
1070603182 10:77879799-77879821 CAGGAAAAACAGATGGGGGAGGG + Intronic
1071207318 10:83296321-83296343 CAAGAACAAGAAATGGAGAAAGG + Intergenic
1071776263 10:88791776-88791798 CAGAAAAAAAAAATAGAGAAGGG - Intergenic
1071839014 10:89449489-89449511 CAAAAATAACAAATGGAGAAAGG + Intronic
1072914691 10:99530717-99530739 CTGGAAAAAGAAAAGGAGAAAGG - Intergenic
1073223597 10:101897061-101897083 CTGGAAAAATAAATTGGTAAAGG - Intronic
1073340672 10:102742140-102742162 TTGGTAAAATAAATGGACAAAGG - Exonic
1073359659 10:102887849-102887871 CTGGAAAAAGAAGAGGAGGAAGG - Intronic
1073727838 10:106255005-106255027 CTTGAAAAACGTAAGGAGAATGG + Intergenic
1074033887 10:109718346-109718368 CAGGAAAAACACATGGAAGATGG + Intergenic
1074233589 10:111562135-111562157 CTGGAAAGGCAAATGGAGAATGG + Intergenic
1074363434 10:112840018-112840040 CTGGATACACAAATGGAGGAGGG + Intergenic
1074883230 10:117674594-117674616 CTTGAAAATCTAATGAAGAATGG - Intergenic
1075535825 10:123271346-123271368 CTGAATAAACAAAAGGTGAAGGG + Intergenic
1076066477 10:127452064-127452086 ATGGAAAAACAAATGAATACAGG + Exonic
1076621822 10:131793870-131793892 CTGGAAAAAAAGGTGGAAAAGGG - Intergenic
1076814840 10:132909610-132909632 CTGGAAAGCCAGATGGAGGAGGG - Intronic
1077553186 11:3212939-3212961 CTGGATCAACTTATGGAGAACGG - Intergenic
1077768390 11:5187403-5187425 ATAGAAAAAGAGATGGAGAAAGG + Intergenic
1077783707 11:5359875-5359897 CAAAAAAAACAAATGGGGAAAGG + Intronic
1077958104 11:7043161-7043183 CTGAAGCAGCAAATGGAGAAGGG + Exonic
1078044700 11:7903145-7903167 CTGGAAAAACAGATAGCTAAGGG - Intergenic
1078107215 11:8365881-8365903 CTGGAAGGACAAATGGAGAGGGG - Intergenic
1078110828 11:8390435-8390457 CTGTGAAAGCAAATGGAGGAAGG + Intergenic
1078178124 11:8985982-8986004 CTGGAACAACATATGTAGGATGG - Intronic
1078561102 11:12373491-12373513 TGGGAAAAATAAATGCAGAAAGG + Intergenic
1078750963 11:14163449-14163471 CTGGAGAAATAAAAGGAGAATGG - Intronic
1081085969 11:38801899-38801921 CTGGACAAACTACTGGAGGAGGG - Intergenic
1081317621 11:41650185-41650207 GAGGAAAAACCAATAGAGAAAGG - Intergenic
1081557362 11:44177781-44177803 CTGGTAAAGTAAATGCAGAAAGG - Intronic
1082897352 11:58205928-58205950 GAGGAAAAACACATGCAGAAGGG + Intergenic
1083096033 11:60252481-60252503 CAGCAAAAACAAATGCAGATGGG + Intergenic
1083269688 11:61565570-61565592 GAGGAAAAACAAATTGAGATAGG + Intronic
1083493686 11:63032108-63032130 CTAGGAAAACAAAGGGAAAAGGG - Intergenic
1084543693 11:69803023-69803045 CTGTAAGAACAAAATGAGAAGGG + Intergenic
1084623870 11:70293264-70293286 CTGGAAAAAGCAATGAAGAAGGG - Intronic
1085786384 11:79455025-79455047 CAGGAAAACAAAACGGAGAAGGG + Intergenic
1086218785 11:84416102-84416124 CTGGAGCACAAAATGGAGAAGGG - Intronic
1086499636 11:87438882-87438904 TTGGAAAAATTAATGGAAAAAGG - Intergenic
1086508661 11:87531720-87531742 TAGGGAAAACAAATGGATAAGGG - Intergenic
1086882279 11:92162763-92162785 CATGAAAAATAAATGGAAAAAGG - Intergenic
1087092555 11:94288729-94288751 CTGGAGAAAGAGGTGGAGAATGG + Intergenic
1087370363 11:97276409-97276431 CTGACAAAAGCAATGGAGAAAGG + Intergenic
1087580585 11:100046881-100046903 CTGGAAAAACACTAGGATAATGG - Intronic
1087606683 11:100385528-100385550 CTGGAAAGAGAAGGGGAGAATGG + Intergenic
1088380622 11:109188649-109188671 CAGAAAAAAGAAATGGGGAAAGG - Intergenic
1090147378 11:124339978-124340000 CTGGAAAGACAAAGGGATACGGG + Intergenic
1091318013 11:134629315-134629337 CTGGATTAAAAAATGGACAAAGG + Intergenic
1091356187 11:134939645-134939667 CTGCCAAAACAAATGGTCAAAGG + Intergenic
1091503327 12:1040702-1040724 CTGGCAAAATAAAGGGGGAAAGG - Intronic
1091504162 12:1050078-1050100 CTGGAAAAGCAAATGGATGTGGG + Intronic
1091541068 12:1463129-1463151 CCGAGAAAACAAATGGAGAAAGG - Intronic
1092202210 12:6592818-6592840 CTGGTGAAGCAGATGGAGAAAGG + Intronic
1092750145 12:11711201-11711223 CTGGGAAAAGAAAACGAGAAAGG - Intronic
1092865028 12:12752886-12752908 CTGGCTAAACAGATAGAGAAGGG - Intronic
1093512823 12:19949174-19949196 CTGAATATACAAATGGACAATGG + Intergenic
1093855339 12:24094954-24094976 TTGGATAAACAAAAGGAGAGAGG - Intergenic
1094104521 12:26796576-26796598 CTAGAAATAGAAATGGTGAATGG - Intronic
1094200510 12:27790644-27790666 CTTGAAAAAGAGATGGACAATGG - Intronic
1094636645 12:32232967-32232989 ATGGAAAATTAAATGGAAAATGG + Intronic
1095361960 12:41353039-41353061 CTGGGAAAACGAAGAGAGAAAGG + Intronic
1095724389 12:45435891-45435913 CTGAATATACAAATGGACAATGG + Intronic
1097033639 12:56107362-56107384 CTAGAGAAGCAAAAGGAGAAAGG + Intronic
1097314211 12:58154831-58154853 CTGAAATAACAAACAGAGAAAGG - Intergenic
1097626620 12:62010044-62010066 ATGTAAAAGCTAATGGAGAATGG - Intronic
1097960184 12:65524644-65524666 AAGGAAATATAAATGGAGAATGG - Intergenic
1098130239 12:67342596-67342618 CTCAAAAAACACATGGGGAAGGG - Intergenic
1098394237 12:70001698-70001720 CTGAAAAACAAAATGGTGAAGGG - Intergenic
1098862343 12:75724197-75724219 ATGGAAACACATATGGGGAAAGG - Intergenic
1100129579 12:91474854-91474876 GTGGATAAAAAAGTGGAGAAAGG - Intergenic
1100129717 12:91476517-91476539 TTGGAAAAAAAAGTGGAGAAAGG - Intergenic
1100172468 12:91991098-91991120 CCTGAAAAACCAATGAAGAATGG - Intronic
1100862602 12:98822290-98822312 CTGGAAAAAGAAAGGGAAGAAGG + Intronic
1102716260 12:114975705-114975727 CTGGAAAACATAAAGGAGAATGG - Intergenic
1104072200 12:125355585-125355607 CTGAATATACAAATGGACAACGG - Intronic
1104181630 12:126387086-126387108 CTGGAAATCTTAATGGAGAAGGG - Intergenic
1104427993 12:128693806-128693828 CTGCAAAGACAGAGGGAGAAAGG - Intronic
1105951499 13:25233196-25233218 CTGGAAAACCAAAGAGAGACAGG - Intergenic
1106008056 13:25789957-25789979 CTGGCAAAAGAAATGGAGAAAGG + Intronic
1106273319 13:28176100-28176122 ATGGTAGTACAAATGGAGAAAGG + Intronic
1106278318 13:28237157-28237179 ATGGAAAAATTAATGGAAAATGG + Intronic
1106347701 13:28895114-28895136 TTAGAAAAACAAAAGGGGAAGGG + Intronic
1106353853 13:28959887-28959909 CTGGCAGAAGAAATGGGGAAGGG - Intronic
1106443714 13:29803610-29803632 CAGAAAAAAAAAAGGGAGAAGGG + Intronic
1107051309 13:36053410-36053432 CTGGAAATAGCCATGGAGAAAGG + Intronic
1107695969 13:43000308-43000330 CTGAAAAAACAAAGTGAGCAGGG + Intergenic
1107791743 13:44009179-44009201 CTGGAAAACCAAGTTGTGAATGG - Intergenic
1108022461 13:46142131-46142153 CTGAAAAAAAAAAAGCAGAAAGG + Intronic
1108076139 13:46681530-46681552 CAGGAGAGAAAAATGGAGAAAGG - Intronic
1108106235 13:47013743-47013765 AAGGAAAAAGAAAGGGAGAAAGG + Intergenic
1108348613 13:49569969-49569991 CTTACAAAACAGATGGAGAAAGG + Intronic
1108524080 13:51271059-51271081 CTGGAAAATGATATGGATAATGG - Intronic
1108971852 13:56386350-56386372 CTGGATAAAAAAATGGGCAAAGG + Intergenic
1108979205 13:56489414-56489436 CAGAAAAAAAAAAAGGAGAAAGG - Intergenic
1110277524 13:73656948-73656970 CTTGTAAAACAAATGAAGTAGGG + Intergenic
1110476959 13:75927613-75927635 AAGGAAAGATAAATGGAGAAGGG + Intergenic
1110564160 13:76941118-76941140 ATAAAAATACAAATGGAGAAGGG + Intergenic
1110932613 13:81241176-81241198 CAGGAAGGTCAAATGGAGAATGG + Intergenic
1111327428 13:86717619-86717641 TTTGAAAAACAAATGAATAATGG + Intergenic
1111685242 13:91493671-91493693 ATGGAAGAGCAAATGGACAAGGG - Intronic
1112273400 13:97992558-97992580 CTGAAAAAATAAAAGGACAAAGG + Intronic
1112563003 13:100530120-100530142 CTGGAGACACAGTTGGAGAAGGG + Exonic
1112732565 13:102381827-102381849 TTGGTAAAACAAATTAAGAATGG + Intronic
1113060070 13:106313580-106313602 CTGGAAGAACCAATGCAGGATGG + Intergenic
1113202798 13:107885817-107885839 CTCTACAAAGAAATGGAGAATGG + Intergenic
1114305734 14:21421080-21421102 CTGAAAAATCAAATGGCAAATGG + Intronic
1114381574 14:22210568-22210590 CTGCAAAAACCAATGGAATAAGG + Intergenic
1115002160 14:28435803-28435825 GTGGAAGAACAAATGGAGAGTGG + Intergenic
1115054433 14:29105578-29105600 CTGGAATAATAAGGGGAGAAGGG - Intergenic
1115299828 14:31871814-31871836 CTGGAAGAAAAAAAGGTGAATGG + Intergenic
1115654450 14:35429941-35429963 CAGGGGAAACAAATAGAGAAGGG + Intergenic
1115794073 14:36912971-36912993 CTGGGAAAAAAAAAGGAGAAAGG - Intronic
1116043117 14:39710046-39710068 CTGGAGTTAAAAATGGAGAAAGG - Intergenic
1116145864 14:41068503-41068525 CTTGAAAGACAAAAGGAAAAAGG + Intergenic
1116360230 14:43985225-43985247 CTTAACAAACAAAAGGAGAAAGG - Intergenic
1116837383 14:49783409-49783431 CTGGAAAAACAAAGTGTGGAGGG + Exonic
1118152589 14:63205423-63205445 CTAGACACACAAATGGTGAAAGG + Intronic
1118510959 14:66472739-66472761 ATTGAAAAGCAAAAGGAGAATGG + Intergenic
1118686667 14:68298319-68298341 CTGGGAGAACAAAAGGAGAAAGG + Intronic
1118733748 14:68687695-68687717 GTAGAAAAAAAAATAGAGAAGGG + Intronic
1118879533 14:69814433-69814455 CTGGCAAAACAGATAGAAAAAGG + Intergenic
1118902534 14:69998843-69998865 CTGGAAAAAAACAGGGACAAAGG - Intronic
1119294692 14:73523306-73523328 CTTGAAAAACAGATGGAAAGGGG + Intronic
1119489223 14:75016081-75016103 CGGGAAAAATAGATTGAGAATGG + Exonic
1119921807 14:78453549-78453571 CTGGAAAAAGGAATGAAGAAAGG - Intronic
1121165119 14:91788375-91788397 CTGAAAAATAAAAGGGAGAATGG + Intronic
1121566351 14:94912907-94912929 CAGGAAAAAAAAAAGGTGAAGGG - Intergenic
1121749058 14:96331262-96331284 TTAGAAAAACAAATGCAGATAGG + Intronic
1121883540 14:97522290-97522312 CAGGAAAAACCAAAAGAGAAAGG - Intergenic
1122573355 14:102724209-102724231 CTGCAAAACAAAATGAAGAATGG + Intronic
1122687460 14:103516539-103516561 CTCGAAATAGAAATGCAGAAGGG + Intergenic
1122869128 14:104626964-104626986 TTGGAGAAATAACTGGAGAAGGG + Intergenic
1123166917 14:106334475-106334497 CAGGAAAAACAAATGGAAAAAGG + Intergenic
1123169532 14:106359186-106359208 CAGGAAAAACAAATGGAAAAAGG + Intergenic
1123173423 14:106396048-106396070 CAGGAAAAGCAAATGAAAAAGGG + Intergenic
1124716120 15:32063892-32063914 CTGGATCCACAAATGGAGAATGG - Intronic
1126336101 15:47587867-47587889 CTGACAATGCAAATGGAGAAAGG - Intronic
1126538569 15:49796243-49796265 CTGGAACAAAAACTGGAGAAAGG - Intergenic
1127064439 15:55222342-55222364 CAGGAAAAACACATAGAGTAGGG - Intronic
1128036042 15:64527657-64527679 CTGGAGAAAGGAATGGAGAGAGG - Intronic
1128704352 15:69827829-69827851 CTGGGAACACAAATGGACCAAGG - Intergenic
1129176154 15:73841089-73841111 ATGGAAAAAGCAATGGAGACAGG + Intergenic
1129615764 15:77097944-77097966 CTGGGAAAATAAATGGAACATGG - Intergenic
1130542284 15:84829103-84829125 CTGGGAAGACAAATTGAGAGGGG - Intronic
1130810522 15:87372805-87372827 CAGGAAAAACAAATAAATAAAGG - Intergenic
1131569904 15:93524121-93524143 CAGGAAAAAGGAAGGGAGAAGGG - Intergenic
1132037339 15:98496327-98496349 GTGGAAAAAGAAATCGAGAAAGG - Intronic
1132437834 15:101824806-101824828 CTGGAGAGACAAATGGAAACTGG - Intergenic
1133598541 16:7316834-7316856 CTGGAAAAACAAAGGGACCAGGG + Intronic
1133663004 16:7937130-7937152 CAGGAAGGACAAAGGGAGAAAGG + Intergenic
1133954594 16:10430296-10430318 CTGGATAAAAAAATAGTGAATGG + Intronic
1134345765 16:13389932-13389954 GTGGAAAAAAGAATGGAGAATGG - Intergenic
1134511817 16:14854720-14854742 CTAGAAAAATAAAGGAAGAAAGG + Intronic
1134699460 16:16253219-16253241 CTAGAAAAATAAAGGAAGAAAGG + Intronic
1134972369 16:18541452-18541474 CTAGAAAAATAAAGGAAGAAAGG - Intronic
1135385082 16:22031954-22031976 CTGGTAACAGAAATGGAAAATGG - Intronic
1135476328 16:22779223-22779245 ATTGAAAAAGAAATGCAGAAAGG + Intergenic
1135801793 16:25504074-25504096 CTGGGTACACATATGGAGAATGG + Intergenic
1135823087 16:25702141-25702163 TTAGAAAAACAAAAGGAGAAAGG + Intronic
1136108462 16:28048971-28048993 CTGGAGAAAAAAAGGGAGAAGGG + Intronic
1137387975 16:48058390-48058412 CAGGGAAAACACATAGAGAAAGG - Intergenic
1137653020 16:50136544-50136566 CTGGAGAAATAACTGCAGAATGG + Intergenic
1137820732 16:51442788-51442810 ATGGAGAATCAAATAGAGAAGGG + Intergenic
1138191918 16:55020629-55020651 CAGGAAAAACAAATACTGAAGGG + Intergenic
1138799616 16:60012139-60012161 CTAGAAAAAAAAAAGGAGAGAGG + Intergenic
1139566703 16:67782066-67782088 CTGGAAAAGCAAAGAGAAAAAGG - Intronic
1140641636 16:76980357-76980379 CTGTTAAATCAAATGGAGATGGG + Intergenic
1141002456 16:80320756-80320778 CTGGAATAACAAGATGAGAAAGG - Intergenic
1141569815 16:84927844-84927866 CTGGACAAACACTTGGAGTAGGG - Intergenic
1143762597 17:9115999-9116021 CCGGAGAAACAAATGCAGAGAGG - Intronic
1144146236 17:12401246-12401268 CAGGATAAACAAAAGGAGAAAGG + Intergenic
1144264788 17:13557657-13557679 CTGAAAATACAAAAGTAGAAAGG + Intronic
1144289448 17:13812474-13812496 TTGCAAAAACATAGGGAGAAAGG + Intergenic
1144406616 17:14958055-14958077 CTGGAAAAAGAATAGGAGGAAGG + Intergenic
1145269652 17:21397908-21397930 CTGAAAGAAGAAAAGGAGAAGGG - Intronic
1145836903 17:27961245-27961267 CTGGGAAGAAAAATGGAGAAAGG - Intergenic
1146490205 17:33275642-33275664 GTGCAAATCCAAATGGAGAATGG + Intronic
1146953155 17:36920561-36920583 ATGGAAAAGCAAGAGGAGAAAGG - Intergenic
1147745443 17:42691783-42691805 CTAGAAAAGCAGATGGAGGAAGG - Intronic
1148011961 17:44489666-44489688 CTAGAAAAACAAAAAGAGGAAGG + Intronic
1148052560 17:44776257-44776279 CGGGAAAACCAAATCGACAAGGG - Intronic
1149081749 17:52666168-52666190 CTGAAAAATCAACTGAAGAAAGG + Intergenic
1149200094 17:54175458-54175480 GTGGAAGCACAGATGGAGAAAGG + Intergenic
1149210786 17:54297881-54297903 CTGGAATAACAAATGATGAGAGG + Intergenic
1149215685 17:54351163-54351185 CAAGAAAAACAAAAGAAGAAAGG + Intergenic
1149749047 17:59127914-59127936 CTGGATAAGAAAATGGAGTATGG + Intronic
1150028452 17:61704235-61704257 CTACAAAAACAAAAGGAAAAGGG - Intronic
1151108244 17:71644315-71644337 CCTGAAAGACACATGGAGAACGG + Intergenic
1151800356 17:76375870-76375892 CTGGAAAAAGACATGGAGCCCGG - Intronic
1151920226 17:77149044-77149066 CTGGAGAGACAGATGGGGAATGG - Intronic
1152315404 17:79577745-79577767 CTGGAAAACCCAAAGGAGAAGGG + Intergenic
1152905025 17:82965298-82965320 CTGGGACAACAGAGGGAGAAGGG - Intronic
1152958022 18:56741-56763 CTGTAAAAACAATTGGTGACTGG + Intronic
1152986233 18:323950-323972 CTGGAAAAACAAATGGAGAAAGG - Intronic
1153162143 18:2218659-2218681 CTGGAGAAGCAAATGCTGAATGG - Intergenic
1153187859 18:2504947-2504969 TTGACAAAACAAAAGGAGAATGG + Intergenic
1153428445 18:4990611-4990633 CTGGAAAGAAAAATGAACAAAGG - Intergenic
1153654824 18:7273236-7273258 CTAAAAAAACAAAAGGATAATGG + Intergenic
1153822390 18:8843394-8843416 CTGGGAAAGCAAATGGAGCCAGG + Intergenic
1154062697 18:11077950-11077972 CTGGAAACAGCAATGGAAAAAGG + Intronic
1155068345 18:22288509-22288531 ATGGAAATACAAATGGCCAAGGG - Intergenic
1156259390 18:35430516-35430538 CTGGAAAAACCATGAGAGAAGGG + Intergenic
1156396590 18:36704901-36704923 CTGGAAGAACACATGGGTAAGGG - Intronic
1156422563 18:36971178-36971200 CTGACAAAAGCAATGGAGAAAGG + Intronic
1156488789 18:37484374-37484396 CTGAAAAAACAACTGGGGAATGG + Intronic
1157139117 18:45088106-45088128 CTGAATATACAAATGGACAATGG + Intergenic
1157175051 18:45443977-45443999 CTGGAAACACACATGGAGAGTGG + Intronic
1157206534 18:45705051-45705073 CAGAAACAAGAAATGGAGAAAGG + Intergenic
1158179494 18:54697996-54698018 TTGTAAAAATAAATGTAGAAAGG + Intergenic
1158248292 18:55456563-55456585 CTGGAATAATAAAAGGAAAATGG + Intronic
1158300493 18:56046807-56046829 CTGGAAAAAAAAGTGGTGAGAGG - Intergenic
1158371048 18:56804976-56804998 CAGGGAGAACAAATGCAGAAGGG - Intronic
1158789128 18:60754447-60754469 CTGAATATACAAATGGACAAGGG + Intergenic
1159422292 18:68237754-68237776 CTGGAAAGACAATTTCAGAAAGG + Intergenic
1159611821 18:70534043-70534065 CTGGGATGACAACTGGAGAAAGG - Intergenic
1159638185 18:70831426-70831448 CTGAATACACAAATGGACAATGG + Intergenic
1160098635 18:75900166-75900188 TTTGAAAAACAAATAGACAAAGG - Intergenic
1161673113 19:5625211-5625233 CTGGAAAAATAAACCAAGAAAGG - Intronic
1161761040 19:6173035-6173057 CTGGGAAAAGACATGGAGAAGGG - Intronic
1161879113 19:6934935-6934957 CTGGATATACAAATAGACAAGGG - Intronic
1161943783 19:7421914-7421936 CTGGAAGAAGGAAGGGAGAAGGG - Intronic
1162565501 19:11444097-11444119 CACCAAAAACAAATGAAGAAGGG - Intronic
1162595201 19:11623269-11623291 CTGGAAAAACAGATAGAAAAGGG - Intergenic
1162609774 19:11739884-11739906 CTTCATAAACATATGGAGAAAGG - Intergenic
1163894815 19:20049452-20049474 CAGGAAAAACTAGTGGAGGATGG + Intergenic
1164073505 19:21791387-21791409 CTGGAAAAACAGATAGAAAAGGG - Intergenic
1164413506 19:28025543-28025565 TAGGAAAATCAAAGGGAGAATGG - Intergenic
1164781063 19:30893253-30893275 CTGAAAACACAGATGGAGAATGG + Intergenic
1164857387 19:31535709-31535731 CTGGGAAGGGAAATGGAGAATGG + Intergenic
1164986542 19:32652630-32652652 GAGGAAAAACAAAAGGAGACAGG + Intronic
1165139804 19:33691929-33691951 GTGGCACAACAAATGTAGAAAGG + Intronic
1165277471 19:34767418-34767440 ATGGAGAAACAAATGGAGTATGG + Intronic
1166148220 19:40851526-40851548 CAGGAAAACCAAATCCAGAAAGG - Intronic
1166152362 19:40883311-40883333 CAGGAAAACCAAATCCAGAAAGG - Intronic
1167192976 19:48004589-48004611 CTGGAGGAACAGATGGAGGAGGG - Intronic
1167808630 19:51809015-51809037 CTGGAAAAACAGATAGAAAAGGG - Intronic
1167882849 19:52476477-52476499 CTGGAAAAACAGATAGAAAAGGG - Intronic
1168269946 19:55244364-55244386 CTGGAGAAACACATGGACATGGG + Intronic
1168351452 19:55678484-55678506 CTGGAAACACAAATGGGACATGG - Intronic
1168384940 19:55955274-55955296 CTGAAACAGCAAATGGAGAGAGG + Exonic
1168443042 19:56388337-56388359 ATGAAGAAACAAATGGTGAAAGG + Intronic
925085474 2:1104574-1104596 GGGAAAACACAAATGGAGAAAGG + Intronic
925663165 2:6224273-6224295 CAGGAAAAACAAGGGGAGACAGG + Intergenic
925779822 2:7371979-7372001 CTGGGAAGACAAATGGAGACTGG + Intergenic
926706226 2:15839667-15839689 CAGGATAAACAAATGGTGCATGG + Intergenic
926746338 2:16161435-16161457 CTGGAAATACACAGGGAGGATGG + Intergenic
926954621 2:18280949-18280971 CTGGACCAAAAAAGGGAGAAAGG + Intronic
927061319 2:19424946-19424968 CTGGATATACAGATGGAGACTGG - Intergenic
927670861 2:25067849-25067871 TTGGAAAAAAAAATAGAGATGGG + Intronic
928209614 2:29313821-29313843 GAGGAAAAACAAAAGCAGAAGGG - Intronic
929261059 2:39866997-39867019 CTGTAAAAACATATGTTGAATGG + Intergenic
929915015 2:46127834-46127856 CTGGAAAATCAATGGGAAAATGG + Intronic
929917878 2:46151326-46151348 CTGGACAGAGAAAGGGAGAAGGG - Intronic
930684439 2:54292882-54292904 CTGGAATAACAAATCTAGATTGG - Intronic
931200435 2:60092476-60092498 CTGGCAAAAGAAAAGGAAAAAGG - Intergenic
931570448 2:63663574-63663596 CTGGCTATAGAAATGGAGAAAGG + Intronic
932109037 2:68977214-68977236 CTGGAAAAATTGATGAAGAAGGG - Intronic
932115775 2:69045571-69045593 TTGGAAAAAGAAAAGGAGGAAGG + Intronic
932305632 2:70701162-70701184 CTGGAAAATCAAATCCAGAAGGG + Intronic
932646260 2:73506051-73506073 CTGACAAAAGCAATGGAGAAAGG - Intronic
932865351 2:75335675-75335697 CTGAATATACAAATGGACAATGG - Intergenic
932940952 2:76164557-76164579 TTGGAAAAAAAAAAGGAAAAAGG - Intergenic
933142383 2:78808747-78808769 CTTGAAAATAAAAAGGAGAAGGG + Intergenic
933386515 2:81618052-81618074 TGACAAAAACAAATGGAGAAAGG + Intergenic
933827605 2:86177782-86177804 CTATAAAAACAAGTGCAGAATGG - Intronic
935426627 2:102925722-102925744 CTGGGGAAAAAAAAGGAGAAAGG + Intergenic
937079020 2:119127039-119127061 CTGGAAAAAGAAAAAAAGAAAGG - Intergenic
937079024 2:119127080-119127102 CTGGAAAAAGAAAAAAAGAAAGG - Intergenic
938929486 2:136074194-136074216 CTGGAAAAACAGATAGAAAAGGG - Intergenic
939096354 2:137837413-137837435 CTGGAAAAATACATGGGGACAGG + Intergenic
939133981 2:138272857-138272879 TTGTATAAACAAATGGAAAAAGG - Intergenic
939152393 2:138488334-138488356 CTGAATAAATAACTGGAGAATGG + Intergenic
939165788 2:138639952-138639974 ATGGAAAAACAAATGGATCTGGG + Intergenic
939240158 2:139547980-139548002 CTGTAAAAAAAAATTCAGAAGGG - Intergenic
939446976 2:142322572-142322594 ATGGAAAAAAAAATGGAAACAGG - Intergenic
939464984 2:142545384-142545406 CTGGAAAAATAAATAAATAAAGG - Intergenic
939669840 2:144996942-144996964 ATGGAAAATGAATTGGAGAAGGG + Intergenic
939731950 2:145795893-145795915 TTAGAAAAAAAAATGGATAATGG - Intergenic
939763555 2:146216108-146216130 CTAGAATCAGAAATGGAGAATGG + Intergenic
940513451 2:154649195-154649217 CTGGCAAAACAAAGGGGAAAAGG - Intergenic
941755741 2:169183925-169183947 CTGAAAACACAAAGGCAGAATGG - Intronic
942384838 2:175431740-175431762 CTTGAAAAACAGATGAAGAGTGG + Intergenic
942440876 2:176035166-176035188 CTGGTGAAACAAATGGCCAATGG - Intergenic
943095307 2:183421306-183421328 CTGACAAAAGCAATGGAGAAAGG + Intergenic
943122842 2:183758498-183758520 CTTGCTAAACAAATGCAGAATGG + Intergenic
944396019 2:199267038-199267060 CTGGCAAAGCAGATGGGGAAGGG + Intergenic
944868200 2:203882841-203882863 CTGGAAAAAAAAATAGTGAATGG + Intergenic
944984636 2:205161535-205161557 CTGGAACAACAGTAGGAGAATGG - Intronic
945420550 2:209630725-209630747 AGGGAAAGACAAATGGATAAAGG + Intronic
945612322 2:212019439-212019461 ATGGAAAAACACATGTAAAAGGG + Intronic
945640881 2:212428369-212428391 CTGGAAAAACCAATGAGGCAAGG - Intronic
945729599 2:213517685-213517707 TGACAAAAACAAATGGAGAAAGG + Intronic
945828877 2:214758916-214758938 CTGCAAAAACATATGCAAAAAGG + Intronic
945895557 2:215477717-215477739 TTGGATAAAGAAATGCAGAAAGG - Intergenic
945978529 2:216289538-216289560 ATGGAGAAACAACTGGAGACTGG - Intronic
946081213 2:217120134-217120156 CTGCTAAAACAAATGAGGAAAGG - Intergenic
946553209 2:220824975-220824997 CTTGGAAAAAAAATGGAAAAAGG - Intergenic
946826933 2:223688919-223688941 CTGGTAAAACAAGTGGAGCTGGG - Intergenic
946890141 2:224267046-224267068 GGGGAAAAAGAGATGGAGAAAGG - Intergenic
947091198 2:226513086-226513108 TTGGACAACCAAATAGAGAATGG + Intergenic
947674412 2:231964134-231964156 GACAAAAAACAAATGGAGAAGGG - Intronic
948161100 2:235825278-235825300 CTGGAAATTCAAAAGGATAACGG - Intronic
1168871362 20:1131293-1131315 CTTAAAAAACAAATAGAGACAGG - Intronic
1169355555 20:4902010-4902032 CTCAAAAAACAAATGATGAATGG - Intronic
1170003659 20:11642672-11642694 CTGGAAAATCCAATGCATAATGG - Intergenic
1170281661 20:14655959-14655981 CTGGAAATAGAAATGAAGAAAGG + Intronic
1170327453 20:15172255-15172277 GTGGAAAAAAAAATGGAGGTTGG + Intronic
1170956966 20:20990329-20990351 CTAGAACCAAAAATGGAGAAAGG - Intergenic
1171046999 20:21818224-21818246 GTGGAAAAATAAATGGAACAAGG + Intergenic
1171775892 20:29367319-29367341 CTGACAAAAAAAATGGGGAAAGG - Intergenic
1172017332 20:31885470-31885492 CTGGATAAACATATGGAAAATGG + Intronic
1172179914 20:32996607-32996629 TTGGAAGAACAGATGGATAAGGG - Intronic
1173916679 20:46713285-46713307 CAGAAAAAACAAGTGGAGAAGGG + Intronic
1173954113 20:47017543-47017565 CAGGAAAAAAAAATTGTGAAAGG + Intronic
1174222044 20:48963765-48963787 CAGGAAAAACAAAGGAAGAGAGG - Intronic
1174656259 20:52174980-52175002 TTGGAAAAATAAATGTTGAAAGG - Intronic
1174722578 20:52829190-52829212 ATGAAACAACAAATGGAGAGTGG - Intergenic
1175209907 20:57347422-57347444 CTAGAAACAAAAAGGGAGAACGG - Intergenic
1175253086 20:57621519-57621541 CAGGAAACACAATTGGGGAATGG - Intergenic
1176926060 21:14750324-14750346 ATGGAATAAGAAATGGACAAAGG + Intergenic
1176947913 21:15006399-15006421 CTAGAACAACAAAAGGAAAAAGG + Intronic
1176991728 21:15505365-15505387 CATGAAAAACAAATGGGCAAAGG - Intergenic
1177108594 21:16994695-16994717 ATGGAAAAAGAAATGGAAAATGG - Intergenic
1177192056 21:17862978-17863000 ATGGAATAAGTAATGGAGAAGGG + Intergenic
1177378471 21:20305363-20305385 CTAGATAAACAAATGGACAATGG - Intergenic
1177515423 21:22145271-22145293 CTAGGAAAACAAAGGTAGAAAGG - Intergenic
1177568306 21:22852456-22852478 ATGGAACAAAAACTGGAGAAAGG - Intergenic
1177723566 21:24938850-24938872 ATGCAAGAACAAATGCAGAAGGG - Intergenic
1177847990 21:26313898-26313920 CTGGAAAATCATGTGAAGAAGGG - Intergenic
1178661673 21:34511834-34511856 CTGCAGAAGCACATGGAGAAGGG - Intergenic
1178686803 21:34718274-34718296 CTTGAAACCTAAATGGAGAATGG - Intergenic
1179010414 21:37552028-37552050 CTGAACATACAAATGGACAATGG + Intergenic
1179188774 21:39106278-39106300 GGGGAAAAAGAAAGGGAGAAAGG - Intergenic
1179438073 21:41375593-41375615 CTGGAGACACACAGGGAGAAGGG - Intronic
1180038992 21:45266129-45266151 CTGGAGAAACCCCTGGAGAAGGG - Intronic
1181537103 22:23552068-23552090 ATGGGAAGATAAATGGAGAATGG - Intergenic
1182266222 22:29117706-29117728 CATGAGGAACAAATGGAGAAAGG + Intronic
1182385168 22:29932868-29932890 CAGGGAAAAAATATGGAGAAAGG - Intronic
1184144310 22:42599882-42599904 CTGGAGAAACAAAGGGACCAAGG + Intronic
1184173892 22:42775120-42775142 ATGGAGAAACAACTGGAGACTGG + Intergenic
1184306487 22:43606416-43606438 CTGGGTGAACAAATGAAGAAAGG + Intronic
1184362197 22:44025197-44025219 GTGGAAAGGCAGATGGAGAAAGG + Intronic
949139089 3:610431-610453 CAGGAATCAGAAATGGAGAAAGG - Intergenic
950277179 3:11672015-11672037 GGAGATAAACAAATGGAGAAAGG - Intronic
950422701 3:12908078-12908100 CTGGAAGAAGAAAGGGAAAATGG + Intronic
950623603 3:14227512-14227534 CTGGAAAAACAGATAGAAAAGGG + Intergenic
951337361 3:21440556-21440578 TTGGAAAATCAAATAAAGAATGG + Intronic
951677418 3:25257930-25257952 GTGGAAATACAAATGATGAAGGG - Intronic
952540338 3:34360725-34360747 ATGGAAAAACAAATTTATAATGG - Intergenic
952576353 3:34778705-34778727 GTGGGGAAATAAATGGAGAAAGG + Intergenic
954172317 3:48814616-48814638 CTGGAAATACAAATGGAACAAGG - Intronic
954836064 3:53469221-53469243 CAGAAACAAGAAATGGAGAAAGG - Intergenic
955302223 3:57791552-57791574 CTTGAAAAACAGTTTGAGAAGGG + Intronic
955595682 3:60587949-60587971 AGGGAAAAAAAAAAGGAGAAGGG - Intronic
955786483 3:62545881-62545903 ATGGAAAAATACATAGAGAAGGG - Intronic
955868692 3:63413921-63413943 CTAAGAAAATAAATGGAGAAAGG - Intronic
955900531 3:63748949-63748971 CAGGAAAAGCAAATGTAGAATGG - Intergenic
956237061 3:67084078-67084100 CTGAAAATACAAATGGACAATGG - Intergenic
957651543 3:83012831-83012853 ATGGAAAGAAAAAGGGAGAAAGG - Intergenic
957791808 3:84951367-84951389 TTGGATAAAGAAATGGATAAAGG + Intergenic
958479453 3:94628103-94628125 ATGGAAAAAAGAAGGGAGAAAGG - Intergenic
958551052 3:95613226-95613248 GTGGAAAAACAGATGAATAAAGG + Intergenic
958881837 3:99680870-99680892 CAGAAACAAGAAATGGAGAAAGG + Intronic
959296731 3:104544835-104544857 CAGGAAGAACAAAATGAGAAAGG - Intergenic
959317552 3:104826944-104826966 GTGGAATGTCAAATGGAGAATGG + Intergenic
959328281 3:104967385-104967407 CTGGAAAGAGTAATGGAGAGAGG - Intergenic
959349652 3:105245836-105245858 CTGGAAAAAAAAGTGAACAAAGG + Intergenic
959351185 3:105266318-105266340 CAGGAAAAAATTATGGAGAATGG + Intergenic
959370724 3:105522011-105522033 CTGCCAAAACAAATGGAGTCAGG + Intronic
959629165 3:108489088-108489110 CTGGATTAAAAAATGGATAAAGG - Intronic
959677266 3:109050409-109050431 CTTGAACATCACATGGAGAAGGG + Intronic
959682302 3:109109414-109109436 ATGAGAAAACAAATGGAGATAGG - Intronic
959749356 3:109814778-109814800 CTGGCACCACAAAGGGAGAAAGG - Intergenic
960344342 3:116513958-116513980 CTGAAAAATCAAATGGCTAAAGG + Intronic
960414319 3:117365608-117365630 CTAGAAAAATGAAGGGAGAAAGG + Intergenic
960440892 3:117687285-117687307 TTGGAAAAAGATTTGGAGAATGG - Intergenic
960549977 3:118964517-118964539 CAGGAAAAAAGCATGGAGAAGGG + Intronic
960622399 3:119649336-119649358 ATGAATAAACAAATGGAGAATGG - Intronic
961916627 3:130382059-130382081 CCAGAAAAAAAAATGGAGATTGG + Intronic
962057515 3:131887523-131887545 GTGAAAAAACAAATGTAGGAGGG + Intronic
962243474 3:133771336-133771358 CTGATTAAACAAATGAAGAAGGG + Intronic
962833726 3:139167729-139167751 CAAAAAAAAGAAATGGAGAAAGG - Intronic
963134400 3:141887862-141887884 CTGGAAAAAAAAACCCAGAACGG + Intronic
963380407 3:144522853-144522875 CTGAAAACAAAAATGGTGAAAGG + Intergenic
963385631 3:144589332-144589354 ATGAAAAAAAAAATGGAAAAAGG - Intergenic
963688603 3:148470319-148470341 TTGGAAAAAAAAATGGTGGAGGG + Intergenic
963847263 3:150171806-150171828 CCAGAAAATCAAATGGGGAAAGG + Intergenic
964008439 3:151860055-151860077 CTGGAAAAAGGAATGGAGGCAGG + Intergenic
964103331 3:153013639-153013661 ACAGAAAAATAAATGGAGAAGGG + Intergenic
964240582 3:154588824-154588846 CTATAAAAAAAACTGGAGAAAGG + Intergenic
964706114 3:159620464-159620486 CTGGATAAAGAAATAGACAATGG + Intronic
964895942 3:161595387-161595409 ATGGAAATACAAATGGGGATTGG - Intergenic
965076007 3:163977309-163977331 CTGGAATAAAAGAAGGAGAAGGG - Intergenic
965420332 3:168449945-168449967 GTGGGGAAACAAAGGGAGAATGG - Intergenic
965514716 3:169608548-169608570 CTGGAAACACAAATGGAGGGAGG - Intronic
966213054 3:177472458-177472480 AGGGAAAAACAAATGGCAAAAGG + Intergenic
966294601 3:178404702-178404724 CTGGAACCACAAAAAGAGAAAGG - Intergenic
966625294 3:182009239-182009261 CTGGAAACATAAAAGGAAAAAGG + Intergenic
967052227 3:185795343-185795365 CTGGAGAAACAAATGTGGTATGG - Intronic
967218865 3:187232520-187232542 CTGGAAAAACAAAGGGGAGAAGG - Intronic
967580997 3:191154012-191154034 ATGGAAATAGAAATAGAGAAGGG - Intergenic
967599585 3:191369896-191369918 CTGCAAAGACAAGAGGAGAATGG - Intronic
967653242 3:192012778-192012800 CTGAGAAAACAAAAGGAGCAAGG - Intergenic
968073004 3:195799307-195799329 CTGGAAAAAAAAATGTTTAAAGG - Intronic
968164587 3:196454334-196454356 CTGAAGGAAGAAATGGAGAACGG + Intergenic
969166733 4:5322582-5322604 CAGGAAGAAGAAGTGGAGAAAGG + Intronic
969922784 4:10556774-10556796 CTGGTTAAAGAAAAGGAGAAGGG + Intronic
970249703 4:14101415-14101437 CTGGAAATACAATTGGTGCAGGG + Intergenic
970413894 4:15837622-15837644 CTGGAAAAGCACAGAGAGAAAGG - Intronic
970691308 4:18624153-18624175 CAAGAAAATCCAATGGAGAATGG - Intergenic
970758507 4:19455110-19455132 CTGGAACAACAAATGAATACAGG + Intergenic
971141459 4:23929468-23929490 TTGGAAAAATAAAAGGAGTAAGG + Intergenic
971768923 4:30871076-30871098 TTTTAAAAACAAATGAAGAAGGG - Intronic
971964415 4:33534168-33534190 ATTGATAAACAAATAGAGAAAGG + Intergenic
972583672 4:40417373-40417395 CAGGAAAAAAAAATGTAGAAAGG + Intergenic
972763214 4:42127548-42127570 CTTGAGAAACAAATGGAGACAGG + Intronic
973178374 4:47236683-47236705 CAGGTAAAACAAAGGCAGAAAGG + Intronic
973275082 4:48298754-48298776 CTACTAAAACAAATAGAGAAAGG - Intergenic
973657125 4:53059607-53059629 CAGGAAAAAAAAAAAGAGAAAGG - Intronic
974356449 4:60818945-60818967 ATGGAAAAATAAATGAGGAAGGG - Intergenic
974669909 4:65016017-65016039 ATGGATAAACAAGTGGTGAAGGG - Intergenic
974692764 4:65320458-65320480 TAGGAAAAACAAAATGAGAAAGG + Exonic
974938788 4:68439141-68439163 ATGGGAAAACAGATGAAGAAAGG + Intergenic
974962706 4:68723567-68723589 CTGACAAAAAAAATGGGGAAAGG + Intergenic
975181574 4:71351697-71351719 CTAAAAATACAAGTGGAGAAGGG + Intronic
975263308 4:72331065-72331087 CTGCAAAAGCAAAGGGGGAAAGG + Intronic
975503030 4:75108581-75108603 CTGAAAAAGCAAAAGAAGAAAGG + Intergenic
975755548 4:77568103-77568125 CTGGTAACACAAAGGGACAATGG + Intronic
976151672 4:82098830-82098852 CTGCAAAAACTAAAGGAAAAGGG + Intergenic
976560302 4:86493461-86493483 ATCTAAAAACAAATGGAGAAAGG - Intronic
976560347 4:86493830-86493852 TTGGAAAAAGAAAGGTAGAAGGG - Intronic
977663192 4:99614877-99614899 CTGTCAATACAAATGTAGAAAGG + Intronic
977820155 4:101461944-101461966 CTGGAAAAACTAAAAGAGAGAGG + Intronic
978941579 4:114442683-114442705 CTGTGAAAAGAAATGAAGAAGGG + Intergenic
979381331 4:120010178-120010200 TTGCAAAACCAAATGGAGAATGG - Intergenic
979592763 4:122499141-122499163 CTGGAAGAATAAATAGATAATGG - Intergenic
980663993 4:135904448-135904470 GTGAAAAAACAAAAGGAGGAGGG + Intergenic
981250162 4:142591468-142591490 TTGAATAAATAAATGGAGAAAGG + Intronic
981305451 4:143242278-143242300 CTGGAAAAACACTTGAGGAATGG - Intergenic
981735439 4:147945282-147945304 CAGGAAAAAAAAAAGGAGATGGG - Intronic
981884965 4:149663920-149663942 CTGGGGGAAGAAATGGAGAAGGG - Intergenic
982132683 4:152244661-152244683 CTAGCAATACAAAGGGAGAAGGG + Intergenic
982244719 4:153340242-153340264 AAGAAAAAACAAATGAAGAATGG - Intergenic
982385534 4:154797252-154797274 CTAGAAAACCAAATGGAAACAGG + Intronic
983415650 4:167449988-167450010 CTTGAAAAACAAAGATAGAATGG - Intergenic
984448229 4:179865794-179865816 TGGGTAAGACAAATGGAGAAAGG + Intergenic
984990747 4:185378404-185378426 GTGGAAAATGACATGGAGAATGG - Exonic
985219966 4:187693554-187693576 ATGGAAAATCAACTGGAGGAAGG + Intergenic
985764967 5:1772554-1772576 CTGAAAAAGGAAATGAAGAAGGG + Intergenic
986403955 5:7407040-7407062 GTTGAAAACCAAATGGATAAAGG - Intronic
987949032 5:24652379-24652401 CTGAAAAAACAGATGGAAAAGGG + Intergenic
988045459 5:25945781-25945803 TTGAAAAAAAAAATGGTGAAAGG + Intergenic
988691676 5:33578589-33578611 CTGGAAAAAAAAATCAGGAATGG + Intronic
989090559 5:37725878-37725900 CTGGAAAGACAATTGGACAGTGG - Intronic
989533975 5:42542202-42542224 GTGGAAGAATCAATGGAGAAGGG + Intronic
990136177 5:52646032-52646054 CAGGAGAAAGAAAGGGAGAAGGG - Intergenic
991100891 5:62791419-62791441 CTGGAAAAGAAAATGCTGAAAGG - Intergenic
991346906 5:65678723-65678745 CTGGCAAAAGCAATGGGGAAAGG + Intronic
991441683 5:66657009-66657031 CTGCAAAAATAAATAGATAAAGG - Intronic
991469699 5:66954898-66954920 CTCAAAAAAAAAAGGGAGAAAGG + Intronic
991656312 5:68907375-68907397 TTGGAGAAAAAAATAGAGAATGG - Intergenic
991912465 5:71575258-71575280 CTGGAAAAACAAATAGAAAAGGG + Intergenic
992754660 5:79893039-79893061 CTGGAAGAACAAAAGAGGAAAGG + Intergenic
993182282 5:84569849-84569871 CTGGATAAACAAATGTGGCATGG - Intergenic
993337356 5:86677568-86677590 GAGAAAAAACAAAGGGAGAAAGG + Intergenic
993636347 5:90348894-90348916 TCTGAAAAACAAATGGATAAAGG + Intergenic
993643953 5:90439974-90439996 CTTAAAAAAGAAAAGGAGAATGG + Intergenic
993919609 5:93784392-93784414 CTGGCAAAACGATTCGAGAATGG - Exonic
993970977 5:94419543-94419565 ATGGAAAAAGAAAAGGAGATGGG - Intronic
993972462 5:94436384-94436406 CTGACAAAAGCAATGGAGAAAGG - Intronic
994143900 5:96371473-96371495 CTGGAAGAAGAAAGGAAGAAAGG - Intergenic
994380117 5:99060874-99060896 CTGGGAAAATAAATGCTGAATGG - Intergenic
994717886 5:103345960-103345982 ATGCAAAAACAGATGGATAATGG - Intergenic
994981652 5:106882274-106882296 CTGCAAAATAAAATGGAGACAGG - Intergenic
995405114 5:111785951-111785973 CTGGAAAGAAAAATGAAGAGAGG + Intronic
996307702 5:122068816-122068838 ATGAATAAATAAATGGAGAATGG + Intronic
996984288 5:129539871-129539893 CTGGAAACAAATATGGAGAAAGG - Intronic
998000586 5:138621958-138621980 CTGGAAAAAAAAAAAAAGAAAGG + Intronic
998779351 5:145639340-145639362 CTTGAAAACCAGAGGGAGAAGGG + Intronic
998874919 5:146589436-146589458 ATGGAAAAAAAAATGGTGGAGGG + Intronic
999008399 5:148007036-148007058 CTTGCTAAACAAAGGGAGAAAGG - Intergenic
999784079 5:154875279-154875301 CTCAAAAAACAACTGCAGAATGG - Exonic
999854450 5:155578973-155578995 ATGAATAAACAAATGGTGAATGG + Intergenic
999866401 5:155705103-155705125 GTGGAAGAAGAAAGGGAGAATGG - Intergenic
1000046517 5:157526255-157526277 CAGTAATAACAGATGGAGAATGG + Intronic
1000181571 5:158816791-158816813 CTGAAAAAAAAAGAGGAGAAAGG + Intronic
1000294476 5:159901303-159901325 CTGGAAGAGCAAAGGGTGAAGGG - Intergenic
1000412893 5:160952203-160952225 CAGGAAAATCAAGTGGAGGAGGG + Intergenic
1000778140 5:165444517-165444539 CTGGAGAAACTAATTTAGAAAGG - Intergenic
1000969323 5:167696608-167696630 TAGGAAAAACAGATGGTGAAAGG + Intronic
1001851615 5:174972515-174972537 GTGGGAAGACAAGTGGAGAAGGG - Intergenic
1002828699 6:798525-798547 CAGGAAAAATGAATGGAGAAAGG - Intergenic
1004332419 6:14734069-14734091 CTGAATATACAAATGGACAACGG + Intergenic
1006228787 6:32564302-32564324 CTGGAAAAACAGATAGAAAAGGG - Intronic
1007057392 6:38901043-38901065 ATTGAAAAAAAAATGGAGAAAGG - Intronic
1007126396 6:39429386-39429408 ATGGAAAAACAAATCAAGATGGG - Intronic
1007427066 6:41754057-41754079 CAGGAATGAGAAATGGAGAAAGG - Intronic
1007892558 6:45309082-45309104 AAAGAAAAATAAATGGAGAAAGG + Intronic
1008037666 6:46762985-46763007 CTGGTAAAACAAAAGAAGGAAGG - Intergenic
1008141223 6:47834685-47834707 CTGGGAAAATGAGTGGAGAAGGG - Intergenic
1008346160 6:50429281-50429303 CTAGAATAACAAATAGAAAAGGG + Intergenic
1008483871 6:52014554-52014576 CTGGATAAACAGATGGATCATGG + Intronic
1008806613 6:55437415-55437437 GAGGAAAAAAAAATGCAGAAAGG + Intronic
1009178733 6:60490981-60491003 CTTGAAAAATAAAGTGAGAATGG - Intergenic
1009380738 6:63025632-63025654 CTGGAAAAAAAACTAGAGGAGGG + Intergenic
1009814469 6:68713600-68713622 CTGGAAAAATAACATGAGAAAGG - Intronic
1009961339 6:70525841-70525863 CTGAAAAAACAAATTGTAAAGGG - Exonic
1010113560 6:72272082-72272104 TTGGAAATACAAATCAAGAAAGG + Intronic
1010436052 6:75832408-75832430 CTGGAAAAAAAAATACATAATGG - Intronic
1011055666 6:83200909-83200931 CTGGAAAAATAAGTGGGGGATGG + Intergenic
1011388070 6:86818995-86819017 CTTCCAAACCAAATGGAGAAAGG - Intergenic
1011420723 6:87169335-87169357 CTGGAAAAAAAAAAGGAGGCTGG - Intronic
1011447870 6:87462209-87462231 CTGAATATACAAATGGACAAAGG - Intronic
1012353215 6:98279058-98279080 CAGGAAAAGCCAATAGAGAAGGG - Intergenic
1012642832 6:101642387-101642409 ATGGAAAGAGAAATGGAGAATGG - Intronic
1012806635 6:103903108-103903130 CTGGAGGCACAAATGAAGAAAGG + Intergenic
1012958243 6:105593775-105593797 CTGGAAAAAGACATGAAAAATGG + Intergenic
1013470197 6:110457384-110457406 CTCAAAAAACAAAAGGATAAGGG + Intronic
1013475808 6:110506311-110506333 CTGGAAACAGAGATGGAGGAAGG - Intergenic
1013675100 6:112450635-112450657 CTGGAAAGAGGAATGGGGAAGGG - Intergenic
1013834026 6:114310883-114310905 CTGGAAAAGCAAATAGAGTTTGG + Intronic
1014887255 6:126796917-126796939 ATGGAAAAAGAATTAGAGAATGG - Intergenic
1015446604 6:133312829-133312851 ATGGAAAAAAAAAATGAGAAGGG - Intronic
1015481729 6:133719185-133719207 TTAGCCAAACAAATGGAGAAAGG + Intergenic
1015816860 6:137219607-137219629 CTGGAAGAAGAATTGCAGAATGG - Intergenic
1015919437 6:138252095-138252117 GTGGAAGAAGAAATGGGGAAAGG - Intronic
1016034333 6:139370620-139370642 CTGGCAGAATAAATGGTGAAGGG + Intergenic
1016063854 6:139658510-139658532 CTGGCCATACAATTGGAGAAAGG + Intergenic
1017120637 6:151020905-151020927 CTGGAAGAACGTATGGAGGAGGG - Intronic
1017296887 6:152807937-152807959 CTGGAAATGAAAATGGAGGAAGG - Intergenic
1017401533 6:154069950-154069972 AAGGAAAAACAAATGAAGTAGGG + Intronic
1017641315 6:156496936-156496958 CTAGAAAAAAAACTGGAGGAGGG + Intergenic
1017861511 6:158402495-158402517 CTGAGAAAACAAATGAAGACTGG + Intronic
1017987990 6:159461177-159461199 CTGGTAAAGCAACTGGAAAAAGG + Intergenic
1018017132 6:159722669-159722691 CTGAAAATACAAATGGTAAATGG + Intronic
1018021742 6:159767631-159767653 CTGGCAAACCTACTGGAGAAGGG - Intronic
1018563467 6:165126622-165126644 ATGCAAAAATAAATGGAAAATGG + Intergenic
1019180447 6:170184321-170184343 CTGGATAACCAAGTGGAAAATGG - Intergenic
1021059991 7:16099457-16099479 CAGGAAAAACATAAGGAGAAGGG + Intronic
1021249526 7:18306883-18306905 TTGGAAACAGACATGGAGAATGG - Intronic
1021366098 7:19779948-19779970 ATGGAAAAATAAAAGGAAAAAGG + Intergenic
1022010157 7:26301811-26301833 CTGGAAAAAAAAATGGGTATGGG - Intronic
1022295256 7:29044713-29044735 TTGAAAAGACAAATCGAGAAAGG - Intronic
1022628026 7:32058223-32058245 CTGGAGAAAAGAATGGAGACAGG - Intronic
1022645416 7:32224817-32224839 AGGGAAAAACAATTGGAAAATGG + Intronic
1022967044 7:35483494-35483516 TTGAAAAAATAATTGGAGAAAGG - Intergenic
1023087078 7:36581503-36581525 TTGGAAAAACAGATGGGAAATGG + Intronic
1023313993 7:38916398-38916420 CTGGAAAAAAAAATGCAAATTGG - Intronic
1023869608 7:44255980-44256002 CTGGACAGAAAAATGGGGAAAGG - Intronic
1023915255 7:44583605-44583627 CTTCAAAAAAAAATGCAGAAAGG - Intergenic
1024874945 7:54010953-54010975 CTGGACAAAAAAATGGGCAATGG - Intergenic
1026375932 7:69750944-69750966 ATGGAAGAAGAAAAGGAGAAGGG + Intronic
1026550806 7:71366829-71366851 TTGGCAAAACAAATGAAGACTGG - Intronic
1026788008 7:73313817-73313839 CTGGAGAAAGAAATGGACACTGG + Intronic
1027442896 7:78239146-78239168 CAGGAAAATACAATGGAGAAAGG + Intronic
1027526718 7:79278443-79278465 CTGCCAAAACAAAAGGGGAAAGG - Intronic
1027619404 7:80464992-80465014 CTTGCAAAATAAATGGAGGAAGG + Intronic
1027671795 7:81109375-81109397 CTGGAAAAAAAAAAAAAGAAAGG - Intergenic
1028638928 7:93021763-93021785 CAGGAAAAAGAGAAGGAGAAAGG + Intergenic
1028781899 7:94746754-94746776 CTGAATATACAAATGGACAATGG + Intergenic
1028956776 7:96702155-96702177 AGGGAATAACAAATGTAGAAAGG + Intronic
1030230007 7:107197883-107197905 CAGGAAAAACAAATTGAGCAAGG - Intronic
1030552979 7:110987986-110988008 TTAGAAAAACAAATGGAGAAAGG + Intronic
1031168799 7:118264814-118264836 CTGCAAAAATAAAGGGAAAATGG + Intergenic
1031319102 7:120299158-120299180 CTAAAAAAAAAAATTGAGAATGG + Intronic
1031540360 7:122987972-122987994 CTGGTAACATAAATGCAGAAAGG - Intergenic
1031567061 7:123313525-123313547 CTGATAAAACAAATACAGAATGG - Intergenic
1031659143 7:124398584-124398606 GTGGGAAAATAAATGGAAAAGGG + Intergenic
1032374763 7:131401549-131401571 AGGGAAAGACAAAGGGAGAAAGG - Intronic
1032381617 7:131489680-131489702 CTGTAAAAATAAATGGTGGAGGG - Exonic
1032607257 7:133369283-133369305 CTTTAAAAAGAAAAGGAGAAAGG - Intronic
1033021149 7:137725426-137725448 AAGGAAAACCAAAGGGAGAATGG - Intronic
1034018020 7:147608665-147608687 TTGGAAAACAAAATGAAGAAAGG + Intronic
1034212801 7:149379699-149379721 GAGGAAAAACAGATGCAGAAAGG - Intergenic
1034672263 7:152867682-152867704 CTGAATACACAAATGGACAATGG - Intergenic
1034786871 7:153934332-153934354 ATGGAAAAAAAAAAGGAGAAGGG - Intronic
1035078588 7:156198037-156198059 CTGGAGGAACACATGGAGAGAGG - Intergenic
1035310953 7:157968515-157968537 CTGGAAAAACAGAAGGAGGCTGG - Intronic
1035417485 7:158702524-158702546 CTGGAAAAACACAGGCAGGATGG - Intronic
1035819283 8:2574728-2574750 CTGGAAAAAAGAAAAGAGAAAGG - Intergenic
1037044611 8:14282794-14282816 CTAGAAAAACAAATATTGAAAGG - Intronic
1037461855 8:19118495-19118517 CCAGAAAAATAAATGGATAAAGG - Intergenic
1037841400 8:22247834-22247856 CTGGAAAAAAGAATGGATTAAGG - Intronic
1038240756 8:25806304-25806326 CTGGCCAAGAAAATGGAGAAAGG + Intergenic
1038799948 8:30740537-30740559 CTGGAAAAAAAAAAAAAGAAAGG + Intronic
1039119043 8:34125365-34125387 CTGGCCAAACACCTGGAGAAAGG - Intergenic
1039549869 8:38435615-38435637 CTGGAAAGACCAAAAGAGAATGG - Intronic
1039913922 8:41845770-41845792 GGAGAAAAACAGATGGAGAAGGG - Intronic
1040029698 8:42813467-42813489 CTGGAAACTCACAGGGAGAAAGG + Intergenic
1040110914 8:43566868-43566890 CCGGAAAAAAAAATGCAGCAAGG - Intergenic
1040345447 8:46488492-46488514 TTGGAAAAACAGATAGAAAAGGG - Intergenic
1040435043 8:47381913-47381935 CTGGTAGAACAAAGGGAGGATGG - Intronic
1040752180 8:50723785-50723807 ATGGAAAAAAAAAAGGAGAAAGG + Intronic
1041152127 8:54945329-54945351 CTTGATGAAGAAATGGAGAAGGG - Intergenic
1041206416 8:55502916-55502938 CTGGGAAAACATATGCAAAAAGG - Intronic
1042067127 8:64890456-64890478 CAGGAAAAAAAAAGGGAGAGGGG + Intergenic
1042281801 8:67064070-67064092 CTGGAAAGAAAAATGGGGAGGGG - Intronic
1042884271 8:73530735-73530757 CTGAAAAAACAAAAAGATAAAGG + Intronic
1043218263 8:77622916-77622938 CTGAAAAGACAAAAAGAGAATGG - Intergenic
1043283538 8:78500762-78500784 GTGCAAAAAGAAATGTAGAAAGG + Intergenic
1044074976 8:87809437-87809459 TTGGAAAAGCAAGTGGAGAGTGG + Intergenic
1044761384 8:95521185-95521207 CTGGAAAAAAAAAAAAAGAAGGG - Intergenic
1044900310 8:96937015-96937037 CTGGAAAGAAAAAGGGAGGAAGG - Intronic
1045564970 8:103305063-103305085 GTGGAAAAACAAATGGCTACTGG + Intronic
1046057733 8:109098455-109098477 CTGGAAGAAGAACTGGAGGAGGG - Intronic
1046857778 8:119053618-119053640 CTGGAGACACAAATGGAGAATGG - Intronic
1046955369 8:120057884-120057906 CTTCATAAACAAAGGGAGAAAGG - Intergenic
1047112867 8:121810096-121810118 CTGGAAATGGAAATGGACAAAGG + Intergenic
1047148004 8:122227299-122227321 TTGGACAAACAAATGCTGAAGGG + Intergenic
1047172396 8:122506476-122506498 ATGGAAAAACAAAGGAAAAAGGG + Intergenic
1047177505 8:122555465-122555487 CTGTAAATACAAAGGGAGATTGG - Intergenic
1047234874 8:123032106-123032128 CCAGAAAAACAAATGAATAAAGG - Intronic
1047603001 8:126445909-126445931 CAGGAAAAAAAAATGTAGATCGG - Intergenic
1047757684 8:127931266-127931288 CTGGAAACATAAATGGAAAAGGG - Intergenic
1048707769 8:137173295-137173317 CTGGAGACACATATGGAAAAGGG - Intergenic
1049177706 8:141204348-141204370 CTGGATAAACGTATGGAAAAGGG + Intergenic
1049489297 8:142885443-142885465 CTGGATTAAAAAATGGACAAAGG - Intronic
1050225342 9:3448517-3448539 CTTTAAAAAAAAATAGAGAAGGG + Intronic
1050301132 9:4260010-4260032 ATGGAAACACAGAGGGAGAAAGG + Intronic
1051777548 9:20652325-20652347 CTTAAAAAAAAAATGGAGAGAGG - Intergenic
1052115592 9:24645433-24645455 CCTGAAAAAGACATGGAGAATGG - Intergenic
1052275693 9:26673723-26673745 CTTGAAAAGCAACTGGAGAAGGG - Intergenic
1052389347 9:27860389-27860411 ATGGAAAAACAAATGGTCAGTGG - Intergenic
1052972093 9:34382813-34382835 CTGGTACAACACATGGAGGATGG - Exonic
1054804094 9:69381422-69381444 CTGCAAAAGGAAATGGATAATGG - Intronic
1055236648 9:74130861-74130883 TTGTAAAAACAATTGAAGAAAGG + Intergenic
1056275353 9:84989322-84989344 ATGGAAGAATAAATGAAGAACGG - Intronic
1056423184 9:86449791-86449813 CATCAAAAACAAATGGGGAAGGG + Intergenic
1057741908 9:97719414-97719436 CTGGATAAAAAGATGAAGAAAGG + Intergenic
1057999741 9:99852837-99852859 CTGGAAAGACAGATGGTGGAGGG - Intronic
1058041975 9:100312595-100312617 CTGCAAAAAACAGTGGAGAATGG - Intronic
1058092630 9:100822864-100822886 CTGTAACAATAAATGGAGAATGG - Intergenic
1058194940 9:101961250-101961272 CTGGAAAAATAAATAGTTAAAGG - Intergenic
1058203173 9:102068713-102068735 CAGGAAAAACAAACGAAAAAAGG - Intergenic
1058398332 9:104582466-104582488 TTTTAAAAACACATGGAGAATGG + Intergenic
1058406506 9:104682051-104682073 CTAGAAAAAAAAATAAAGAATGG + Intergenic
1058407060 9:104688644-104688666 TTGGAAAGAAAATTGGAGAAAGG - Intergenic
1058713097 9:107698165-107698187 CTGAAAAAAGAAATGGAGAGAGG + Intergenic
1058877033 9:109253198-109253220 ATGGAAAGAAATATGGAGAAAGG + Intronic
1059175996 9:112170663-112170685 CTGAATATACAAATGGACAATGG + Intronic
1203618258 Un_KI270749v1:89889-89911 CAGGAATCAGAAATGGAGAAAGG + Intergenic
1185762677 X:2700636-2700658 ATGGAAAGATGAATGGAGAATGG - Intronic
1186071061 X:5821215-5821237 CTGGAAACACAAATGGCACACGG + Intergenic
1186366541 X:8900544-8900566 CTAAAAAGACAAATAGAGAAAGG + Intergenic
1186771518 X:12822670-12822692 TGAGAAAAACAAAGGGAGAAGGG - Intronic
1186866350 X:13724440-13724462 CAGGAAAAAGCAAGGGAGAAGGG + Intronic
1187071099 X:15889223-15889245 CTGTAAGAACAAATGGAGGAGGG + Intergenic
1187913754 X:24133919-24133941 CTAGAAAAAGAAAAGGAGAAAGG + Intergenic
1188109250 X:26177804-26177826 CTGAGAAAAGCAATGGAGAAAGG - Intergenic
1188109937 X:26185074-26185096 CTGAGAAAAGCAATGGAGAAAGG + Intergenic
1188314554 X:28657329-28657351 CTGGAAAAAAATGTGGAAAATGG - Intronic
1189669588 X:43394128-43394150 TTGCAAAAACAAATGAAGCATGG + Intergenic
1189984458 X:46541868-46541890 CTGGAAGAACAAGTAGAGAGAGG + Intronic
1190176489 X:48155096-48155118 CTGGAAAGAAAAAAAGAGAAAGG - Intergenic
1190303391 X:49068914-49068936 CTGTAAACATAAATGGAGGAAGG - Intronic
1190722432 X:53161099-53161121 CTGGAAAAACAAATAAAGAAGGG - Intergenic
1191139934 X:57105972-57105994 CTGGAAAAACAGATAGCAAAGGG + Intergenic
1191652056 X:63549982-63550004 CTGACAAAAGCAATGGAGAAAGG - Intergenic
1191653246 X:63565034-63565056 CTGACAAAAGCAATGGAGAAAGG - Intergenic
1192106797 X:68325724-68325746 ATGGAAAAGGAAATGGAAAACGG - Intronic
1192815852 X:74591275-74591297 CTGGAACAAAAACTGGAGAAAGG + Exonic
1193276819 X:79598605-79598627 CTGGACAAATAAATAGAGAAGGG - Intergenic
1194013820 X:88594758-88594780 TTGGAAAAATAAATGGGGGAAGG + Intergenic
1194558171 X:95388474-95388496 TTGGAAAAATAAAGGAAGAATGG - Intergenic
1194740314 X:97564722-97564744 TTGCAGAAACAAATGGGGAAAGG + Intronic
1195815811 X:108886031-108886053 CTGTAAAAAAAAATTGAGACTGG - Intergenic
1196253557 X:113489466-113489488 CTGGAAATACAAATGAAGGAAGG + Intergenic
1196487318 X:116227745-116227767 CTGGCAAAAGCAATGGGGAAAGG + Intergenic
1196630572 X:117934528-117934550 ATGGATAAAGAATTGGAGAATGG + Intronic
1197030966 X:121815329-121815351 AAGGAAAAACACATAGAGAAGGG - Intergenic
1197398084 X:125952490-125952512 CTGGAAAAACAAGGAGAAAAAGG - Intergenic
1197622544 X:128766593-128766615 CAAGAAAAACAGAGGGAGAAAGG - Intergenic
1197887770 X:131236151-131236173 CTGGCAAAACTAGTGGAGAATGG + Intergenic
1198226880 X:134653335-134653357 GTTAAAAACCAAATGGAGAAGGG - Intronic
1198500504 X:137240620-137240642 CTACAAAAACAAGTGGAGAAAGG + Intergenic
1198504741 X:137290336-137290358 CTGTAAAAGGAAATGGAGGAGGG + Intergenic
1198920846 X:141724695-141724717 CTGGAAAAATGAATGTAGAAAGG + Intergenic
1199316445 X:146384122-146384144 CTGGAAAGACAAGTAGTGAAGGG - Intergenic
1199556568 X:149115344-149115366 CTGACAAAACAAATGGGGAAAGG + Intergenic
1199684971 X:150257643-150257665 CTGGAGAACAAGATGGAGAAGGG - Intergenic
1200107334 X:153722349-153722371 CTGGAAAAGCAAATGAAAGAGGG - Intronic
1200242197 X:154502810-154502832 CTGAAGGAACAAATGGAGGAAGG + Intergenic
1201742080 Y:17335120-17335142 CTGGAAAATCAGATAGAAAAGGG + Intergenic
1201977164 Y:19864312-19864334 CTTTAAAAACAAATGAAAAAAGG - Intergenic