ID: 1152986631

View in Genome Browser
Species Human (GRCh38)
Location 18:327395-327417
Sequence GGCCCGGACAGTTCCAAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 184}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152986631_1152986637 18 Left 1152986631 18:327395-327417 CCATCCTTGGAACTGTCCGGGCC 0: 1
1: 0
2: 0
3: 6
4: 184
Right 1152986637 18:327436-327458 CGCCACCCTTTCCCCTCAGCTGG 0: 1
1: 0
2: 1
3: 16
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152986631 Original CRISPR GGCCCGGACAGTTCCAAGGA TGG (reversed) Intronic
900098078 1:948444-948466 GGCCTGGGCAGTTCCCAGGGTGG - Intronic
913958360 1:143322193-143322215 GGCCAGGACAGGTCCAGGGCAGG + Intergenic
914052675 1:144147568-144147590 GGCCAGGACAGGTCCAGGGCAGG + Intergenic
914126522 1:144818973-144818995 GGCCAGGACAGGTCCAGGGCAGG - Intergenic
918129468 1:181612661-181612683 AGCTGGGACAGTTCCATGGAGGG + Intronic
921056654 1:211547628-211547650 GGCCCAAACAGTTGGAAGGATGG - Intergenic
921747223 1:218752426-218752448 GGCCCTGACAGTTCCCAGAGAGG - Intergenic
922582983 1:226712275-226712297 GGGCCTGCCAGTTCCCAGGAAGG - Intronic
1063607809 10:7538417-7538439 AGCCGGGACAGTTCAAAGGCAGG + Intergenic
1066759307 10:38738374-38738396 GGCCAGGACAGGTCCAGGGCAGG - Intergenic
1068861643 10:61854018-61854040 TACCAGGACAGCTCCAAGGATGG + Intergenic
1077786391 11:5389103-5389125 GGCCAGGAAATTGCCAAGGATGG + Intronic
1081571698 11:44295478-44295500 GGCCGGGGAAGTTCCTAGGAAGG + Intronic
1081686542 11:45047059-45047081 GACGAGGACAGTCCCAAGGAGGG + Intergenic
1083021176 11:59508860-59508882 GGCCAGGCCAGATCCAATGAGGG - Intergenic
1083063456 11:59898541-59898563 GGGCAGCACAGTTCCAGGGAGGG + Intergenic
1085202203 11:74708539-74708561 GGCCCGGCCAGCTCAGAGGAGGG + Intronic
1087165724 11:95000295-95000317 TGCAAGGACAGTACCAAGGAGGG + Intergenic
1088522474 11:110713555-110713577 GGCCGGCTCTGTTCCAAGGAAGG + Intergenic
1088604098 11:111512440-111512462 GGCCCGCGGGGTTCCAAGGACGG + Intergenic
1090256589 11:125288632-125288654 GCCTCTGCCAGTTCCAAGGAGGG - Intronic
1092009868 12:5100369-5100391 AGCCCATACAGTTCCAAGTAGGG + Intergenic
1092766934 12:11861464-11861486 GGCCCAGACAGATGCAAAGAGGG - Intronic
1094490572 12:30958069-30958091 GGCAGGGACAGCTCCAAGGAAGG + Intronic
1099244697 12:80180748-80180770 GGCCCTGACAGTGTCAAGGAGGG + Intergenic
1103321578 12:120095528-120095550 AACCAGGACAGTCCCAAGGACGG + Exonic
1104814264 12:131637013-131637035 GGCCTGGACAGGACCAGGGAGGG + Intergenic
1108357450 13:49640801-49640823 GTTCTGGAGAGTTCCAAGGATGG - Intergenic
1118582244 14:67313518-67313540 GGCTCTTACAGTTCCCAGGATGG + Intronic
1120850705 14:89166522-89166544 GGCCCGGACAGTCTCAAAGATGG + Intronic
1122113041 14:99514906-99514928 AGCCTGGACAGTTCCCAGGCTGG + Exonic
1202930050 14_KI270725v1_random:27991-28013 GGCCAGGACAGGTCCAGGGCAGG - Intergenic
1123422253 15:20143241-20143263 GGCCAGGACAGGTCCAGGGCAGG + Intergenic
1123442747 15:20303100-20303122 GGCCAGGACAGGTCCAGGGCAGG - Intergenic
1123531481 15:21149781-21149803 GGCCAGGACAGGTCCAGGGCAGG + Intergenic
1124382924 15:29182724-29182746 GGCCAAGACAGTTCTAAAGAGGG + Intronic
1124593620 15:31076009-31076031 GGCACAGAGAGTTCCCAGGATGG + Intronic
1129915203 15:79263950-79263972 GGCCTGAACAGTTACAAGAACGG - Intergenic
1132654931 16:1037779-1037801 GGCCCAGACAGCGCCATGGAGGG + Intergenic
1132945372 16:2529162-2529184 GGCCTGGACAGGGCCAGGGAGGG + Intronic
1136144249 16:28306599-28306621 GGCTCCAACATTTCCAAGGAGGG + Intronic
1136718510 16:32302626-32302648 GGCCAGGACAGGTCCAGGGCAGG + Intergenic
1136723484 16:32340811-32340833 GGCCAGGACAGGTCCAGGGCAGG + Intergenic
1136773454 16:32859524-32859546 GGCCAGGACAGGTCCAGGGCAGG - Intergenic
1136836882 16:33508890-33508912 GGCCAGGACAGGTCCAGGGCAGG + Intergenic
1136841818 16:33546867-33546889 GGCCAGGACAGGTCCAGGGCAGG + Intergenic
1136862500 16:33712108-33712130 GGCCAGGACAGGTCCAGGGCAGG - Intergenic
1136897158 16:34001995-34002017 GGCCAGGACAGGTCCAGGGCAGG + Intergenic
1139475033 16:67198942-67198964 GTCCAGCACAGTCCCAAGGAGGG - Intergenic
1140608545 16:76570462-76570484 GGCAAGGACAGTACCAAGAAGGG - Intronic
1203002948 16_KI270728v1_random:176954-176976 GGCCAGGACAGGTCCAGGGCAGG - Intergenic
1203007921 16_KI270728v1_random:215145-215167 GGCCAGGACAGGTCCAGGGCAGG - Intergenic
1203075870 16_KI270728v1_random:1121634-1121656 GGCCAGGACAGGTCCAGGGCAGG - Intergenic
1203134553 16_KI270728v1_random:1713360-1713382 GGCCAGGACAGGTCCAGGGCAGG - Intergenic
1203147057 16_KI270728v1_random:1809169-1809191 GGCCAGGACAGGTCCAGGGCAGG + Intergenic
1203151983 16_KI270728v1_random:1847164-1847186 GGCCAGGACAGGTCCAGGGCAGG + Intergenic
1142744747 17:1950247-1950269 GGACCGGACAGATGCCAGGATGG + Intronic
1144414337 17:15032094-15032116 GGCCCTGCCGGCTCCAAGGAAGG - Intergenic
1147430267 17:40366637-40366659 GGGCCTGACAGTCCCCAGGAGGG + Intergenic
1151127990 17:71865906-71865928 GGCCTGGAAAGTTCCCAGGGAGG - Intergenic
1152285711 17:79411524-79411546 GGCCAGGGCAGCCCCAAGGAGGG - Intronic
1152986631 18:327395-327417 GGCCCGGACAGTTCCAAGGATGG - Intronic
1154176382 18:12088923-12088945 GGCCAGGACAGAGCCAAGAAAGG - Intergenic
1158091284 18:53716646-53716668 GGCCCAGTCATTTCCACGGAGGG + Intergenic
1160125447 18:76167594-76167616 GGGCAGGACAGTTCCAGTGACGG + Intergenic
1160663632 19:312859-312881 GGCCCTGACATTGCCCAGGAGGG - Intronic
1160871785 19:1281122-1281144 AACTCGGACAGTTCCATGGATGG + Intergenic
1164651459 19:29893683-29893705 GGCCTGGACAGACCCATGGAGGG + Intergenic
1164829563 19:31310109-31310131 GGGCCCCACAGTTCCAGGGATGG - Intronic
1165511547 19:36269217-36269239 GGCCAGGGCAGTTACCAGGACGG + Intergenic
1165512098 19:36271740-36271762 GGCCAGGGCAGTTACCAGGACGG + Intergenic
1165512646 19:36274239-36274261 GGCCAGGGCAGTTACCAGGACGG + Intergenic
1165513197 19:36276782-36276804 GGCCAGGGCAGTTACCAGGACGG + Intergenic
1165513752 19:36279335-36279357 GGCCAGGGCAGTTACCAGGACGG + Intergenic
1165514301 19:36281869-36281891 GGCCAGGGCAGTTACCAGGACGG + Intergenic
1165514855 19:36284408-36284430 GGCCAGGGCAGTTACCAGGACGG + Intergenic
1165515407 19:36286939-36286961 GGCCAGGGCAGTTACCAGGACGG + Intergenic
1165515957 19:36289477-36289499 GGCCAGGGCAGTTACCAGGACGG + Intergenic
1165516508 19:36292012-36292034 GGCCAGGGCAGTTACCAGGACGG + Intergenic
1165517060 19:36294540-36294562 GGCCAGGGCAGTTACCAGGACGG + Intergenic
1165517612 19:36297063-36297085 GGCCAGGGCAGTTACCAGGACGG + Intergenic
1165518165 19:36299598-36299620 GGCCAGGGCAGTTACCAGGACGG + Intergenic
1165518716 19:36302133-36302155 GGCCAGGGCAGTTACCAGGACGG + Intergenic
1165519264 19:36304663-36304685 GGCCAGGGCAGTTACCAGGACGG + Intergenic
1165519813 19:36307178-36307200 GGCCAGGGCAGTTACCAGGACGG + Intergenic
1165520366 19:36309709-36309731 GGCCAGGGCAGTTACCAGGACGG + Intergenic
1165624251 19:37271413-37271435 GGCCAGGGCAGTTACCAGGACGG - Intergenic
1165625868 19:37279003-37279025 GGCCAGGGCAGTTACCAGGACGG - Intergenic
1165626411 19:37281531-37281553 GGCCAGGGCAGTTACCAGGACGG - Intergenic
1165626952 19:37284056-37284078 GGCCAGGGCAGTTACCAGGACGG - Intergenic
1165627494 19:37286580-37286602 GGCCAGGGCAGTTACCAGGACGG - Intergenic
1165628571 19:37291630-37291652 GGCCAGGGCAGTTACCAGGACGG - Intergenic
1165629654 19:37296681-37296703 GGCCAGGGCAGTTACCAGGACGG - Intergenic
1165630196 19:37299208-37299230 GGCCAGGGCAGTTACCAGGACGG - Intergenic
1168107007 19:54171894-54171916 GGCCAGGGCAGTTCCCGGGAAGG + Exonic
1168403242 19:56098094-56098116 GGCCCATACAGCTCCATGGAAGG + Intronic
1202692072 1_KI270712v1_random:99992-100014 GGCCAGGACAGGTCCAGGGCAGG + Intergenic
925000849 2:401763-401785 GGCCCTGTCAGTGACAAGGAAGG - Intergenic
927475611 2:23412185-23412207 GGGCTGGACAGTTCCAGGGTTGG + Intronic
930880359 2:56263497-56263519 GGCCAGGATATTTCCAAGAATGG + Intronic
933954326 2:87353980-87354002 GGCCAGGACAGGTCCAGGGCAGG - Intergenic
934238523 2:90250200-90250222 GGCCAGGACAGGTCCAGGGCAGG - Intergenic
934274672 2:91566510-91566532 GGCCAGGACAGGTCCAGGGCAGG + Intergenic
934322634 2:91982725-91982747 GGCCAGGACAGGTCCAGGGCAGG - Intergenic
934460939 2:94213531-94213553 GGCCAGGACAGGTCCAGGGCAGG - Intergenic
935114988 2:100127671-100127693 GGCCTGGAGAGCTCCCAGGATGG + Intronic
938981434 2:136530884-136530906 GACCAGCAGAGTTCCAAGGATGG + Intergenic
940071438 2:149692604-149692626 GACCCAGCCTGTTCCAAGGAAGG - Intergenic
940165018 2:150761428-150761450 GGCCGGAGCAGTTGCAAGGAAGG + Intergenic
942082774 2:172416951-172416973 GGCCTGGACAGCTAGAAGGATGG + Intergenic
942144743 2:173015725-173015747 GGTCAGGACAGTTCCCAGAAGGG + Intronic
945942165 2:215960879-215960901 GGCCTGGACGGTGTCAAGGAGGG + Intronic
946640557 2:221779436-221779458 GGCCAAGAAAGTTTCAAGGAAGG + Intergenic
947178773 2:227393687-227393709 GGCCCCCAGAGCTCCAAGGAAGG - Intergenic
947827014 2:233113337-233113359 GCCCTGGACACTTCAAAGGAAGG + Intronic
948201710 2:236133911-236133933 GGCCCTGACACCTCCTAGGAGGG - Intergenic
1168928724 20:1604177-1604199 GGCACAGACAGATCCAGGGAGGG + Intronic
1171380765 20:24732332-24732354 GGCCCAGACACTTCCAAGACAGG + Intergenic
1174076687 20:47942372-47942394 GGCCCTGACCGTTCCAAGGGTGG + Intergenic
1176592065 21:8656573-8656595 GGCCAGGACAGGTCCAGGGCAGG - Intergenic
1180274915 22:10633702-10633724 GGCCAGGACAGGTCCAGGGCAGG - Intergenic
1181355306 22:22293207-22293229 GGCCAGGACAGGTCCAGGGCAGG + Intergenic
1182306368 22:29371779-29371801 TGCCCTGACACTTCCAAAGATGG - Intronic
1183383240 22:37501074-37501096 GGCCCGGACAGGTCCCAGGTCGG - Intronic
1184511314 22:44934897-44934919 GGCTGGGACACTTCCCAGGATGG - Intronic
1184928918 22:47665577-47665599 GGTCCAGACAGTTTCAAAGATGG - Intergenic
951226497 3:20127108-20127130 GGCACAGCCAGTGCCAAGGAGGG - Intronic
953246475 3:41199015-41199037 GGCCGGGACAGGTCCTGGGAGGG - Intronic
954457643 3:50608519-50608541 GGCTTGGGCAGTTCCAGGGACGG + Exonic
954618492 3:51982863-51982885 AGCCCGGACAGTGCCTAGAATGG - Intronic
955106152 3:55900483-55900505 TGCTGGGACAATTCCAAGGAAGG + Intronic
961563248 3:127746047-127746069 GGCCCAGACAGAAACAAGGAAGG + Intronic
962254608 3:133861784-133861806 TGCCCAGACAGTTCCTAGAATGG - Intronic
967990436 3:195126310-195126332 GGCCAGGACAGCGCCAAAGAGGG - Intronic
968599348 4:1501792-1501814 GGCCCGGACCACTCCAAGGCTGG + Intergenic
969507029 4:7594479-7594501 AGGCAGGACAGTGCCAAGGAGGG - Intronic
979299519 4:119070423-119070445 GGCAGGGGCAGTACCAAGGATGG - Intergenic
980355139 4:131727684-131727706 GGCCAGGGCAGTTACCAGGACGG + Intergenic
980356762 4:131735150-131735172 GGCCAGGGCAGTTACCAGGACGG + Intergenic
980357301 4:131737638-131737660 GGCCAGGGCAGTTACCAGGACGG + Intergenic
980357845 4:131740133-131740155 GGCCAGGGCAGTTACCAGGACGG + Intergenic
980358376 4:131742616-131742638 GGCCAGGGCAGTTACCAGGACGG + Intergenic
980358915 4:131745113-131745135 GGCCAGGGCAGTTACCAGGACGG + Intergenic
980359455 4:131747586-131747608 GGCCAGGGCAGTTACCAGGACGG + Intergenic
980359995 4:131750054-131750076 GGCCAGGGCAGTTACCAGGACGG + Intergenic
980360537 4:131752549-131752571 GGCCAGGGCAGTTACCAGGACGG + Intergenic
980361078 4:131755021-131755043 GGCCAGGGCAGTTACCAGGACGG + Intergenic
980361620 4:131757504-131757526 GGCCAGGGCAGTTACCAGGACGG + Intergenic
980362161 4:131759976-131759998 GGCCAGGGCAGTTACCAGGACGG + Intergenic
980362703 4:131762459-131762481 GGCCAGGGCAGTTACCAGGACGG + Intergenic
980378031 4:131976050-131976072 GGCCAGGGCAGTTACCAGGACGG - Intergenic
982178242 4:152726761-152726783 AGACTGGACAGTTCCATGGAGGG + Intronic
985486695 5:155904-155926 GGTCCGGACTGTCCCAGGGAGGG - Intronic
990645153 5:57835381-57835403 GGGCCTGACAGTTCCCAGGCTGG + Intergenic
997443621 5:133925908-133925930 GGGTCGGAGAATTCCAAGGAAGG - Intergenic
998366983 5:141638056-141638078 GGCCCGGACAGCTCCCTGGTTGG + Exonic
1001702191 5:173714855-173714877 GGCCGGGACAGTGCAGAGGAGGG - Intergenic
1002539193 5:179894653-179894675 GTCCCGGACAGGTCAAAGGGTGG + Intronic
1004309754 6:14534893-14534915 GGCCTCATCAGTTCCAAGGAAGG + Intergenic
1004709527 6:18156023-18156045 GGCTCTGACAGTCCCCAGGAGGG - Intronic
1006115957 6:31776367-31776389 GTCCCGGACCTTTCTAAGGAGGG + Intronic
1007282592 6:40723415-40723437 GGGCAGAACAGATCCAAGGAAGG + Intergenic
1013355343 6:109341452-109341474 GACCCAGACAGTCCCCAGGATGG + Intergenic
1019373176 7:674166-674188 GGCCTGGACACCTCCCAGGATGG + Intronic
1020940529 7:14528907-14528929 GGCACGGACAGATAAAAGGAAGG + Intronic
1035793136 8:2325986-2326008 GGCATGGACAGATCCCAGGACGG - Intergenic
1035799668 8:2395719-2395741 GGCATGGACAGATCCCAGGACGG + Intergenic
1037911735 8:22747767-22747789 GGCCCTGGCTGTTCCAACGATGG + Intronic
1040311837 8:46240822-46240844 GGGCCGCAGAGTTGCAAGGACGG + Intergenic
1042183389 8:66113713-66113735 GGCCCGGGCAATGCCAAAGACGG - Intergenic
1042975779 8:74467565-74467587 GGCCTGGAGGGTTCCAAGGATGG + Intronic
1047773973 8:128053884-128053906 GGCCCTGTCAGATACAAGGACGG - Intergenic
1049666307 8:143844818-143844840 GGCCCTGGCAGTCCCAAGTAGGG - Intergenic
1052798038 9:32942049-32942071 GCCCCGGACAAGTCCATGGAAGG + Intergenic
1053002461 9:34584836-34584858 GGTCCAGACCTTTCCAAGGAAGG + Intronic
1053643054 9:40106485-40106507 GGCCAGGGCAGTTACCAGGACGG - Intergenic
1053691436 9:40589229-40589251 GGCCAGGACAGGTCCAGGGCAGG - Intergenic
1053763093 9:41359003-41359025 GGCCAGGGCAGTTACCAGGACGG + Intergenic
1054273367 9:63048256-63048278 GGCCAGGACAGGTCCAGGGCAGG + Intergenic
1054302694 9:63390195-63390217 GGCCAGGACAGGTCCAGGGCAGG - Intergenic
1054323903 9:63703712-63703734 GGCCAGGGCAGTTACCAGGACGG - Intergenic
1054401468 9:64716700-64716722 GGCCAGGACAGGTCCAGGGCAGG - Intergenic
1054435076 9:65201020-65201042 GGCCAGGACAGGTCCAGGGCAGG - Intergenic
1054495314 9:65820661-65820683 GGCCAGGACAGGTCCAGGGCAGG + Intergenic
1054541703 9:66270118-66270140 GGCCAGGGCAGTTACCAGGACGG + Intergenic
1058429610 9:104906560-104906582 GGCCAGGTCAGTGCCAAGGTGGG - Intronic
1061357322 9:130116255-130116277 GGCCCAGGCAGGTCCAGGGAGGG - Intronic
1203622116 Un_KI270749v1:135420-135442 GGCCAGGACAGGTCCAGGGCAGG - Intergenic
1190342002 X:49304135-49304157 GTCCCGGACAGGTGCGAGGAGGG + Intronic
1195212033 X:102659795-102659817 GGCCCAGACAGCTGGAAGGAAGG - Intergenic
1201190128 Y:11437901-11437923 GGCCAGGACAGGTCCAGGGCAGG - Intergenic