ID: 1152987146

View in Genome Browser
Species Human (GRCh38)
Location 18:331256-331278
Sequence TCCCTTCAGGATCACACTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 159}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152987146_1152987158 29 Left 1152987146 18:331256-331278 CCCACAGTGTGATCCTGAAGGGA 0: 1
1: 0
2: 0
3: 6
4: 159
Right 1152987158 18:331308-331330 GCGAACGCTGAACATGCCTGAGG 0: 1
1: 0
2: 0
3: 2
4: 30
1152987146_1152987155 7 Left 1152987146 18:331256-331278 CCCACAGTGTGATCCTGAAGGGA 0: 1
1: 0
2: 0
3: 6
4: 159
Right 1152987155 18:331286-331308 AGTCCTTGGAAACACGCCTGGGG 0: 1
1: 0
2: 0
3: 7
4: 99
1152987146_1152987153 5 Left 1152987146 18:331256-331278 CCCACAGTGTGATCCTGAAGGGA 0: 1
1: 0
2: 0
3: 6
4: 159
Right 1152987153 18:331284-331306 CCAGTCCTTGGAAACACGCCTGG 0: 1
1: 0
2: 0
3: 5
4: 111
1152987146_1152987149 -7 Left 1152987146 18:331256-331278 CCCACAGTGTGATCCTGAAGGGA 0: 1
1: 0
2: 0
3: 6
4: 159
Right 1152987149 18:331272-331294 GAAGGGAGCTCCCCAGTCCTTGG 0: 1
1: 0
2: 1
3: 26
4: 243
1152987146_1152987154 6 Left 1152987146 18:331256-331278 CCCACAGTGTGATCCTGAAGGGA 0: 1
1: 0
2: 0
3: 6
4: 159
Right 1152987154 18:331285-331307 CAGTCCTTGGAAACACGCCTGGG 0: 1
1: 0
2: 0
3: 9
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152987146 Original CRISPR TCCCTTCAGGATCACACTGT GGG (reversed) Intronic
900163484 1:1235563-1235585 TCCCTTCAGGATCCCCCAGGAGG + Intergenic
901679732 1:10906130-10906152 TCCCTCGAGGGACACACTGTGGG + Intergenic
901905564 1:12406514-12406536 TCTCTTCAGGTTTACACTGAGGG + Intronic
902082818 1:13832962-13832984 TGGCTTCAGGATGACACAGTGGG - Intergenic
902161154 1:14531462-14531484 ACCCATCAGGATCACGTTGTGGG + Intergenic
902568942 1:17334064-17334086 TCCCTGCAGGATGTCTCTGTAGG + Intronic
906995691 1:50791545-50791567 TTCCATCAGTATCACCCTGTAGG + Intronic
908029836 1:59987521-59987543 GCCCTCCAGGACCACACAGTCGG + Intronic
910269148 1:85374198-85374220 TCCATCCAGGCTCTCACTGTTGG + Intronic
911792615 1:102037595-102037617 TCTTTTAAGGATCACACTTTTGG + Intergenic
912491021 1:110062937-110062959 TCCCTTGGGGATCCCGCTGTAGG + Intronic
913326830 1:117635012-117635034 TCCCATCAGGGTCACAATTTCGG + Intergenic
915979161 1:160409423-160409445 TCCCTTCAGGAGGACACAGCTGG - Intronic
916374278 1:164135065-164135087 TCTCTGTAGGATCACACTGATGG - Intergenic
919582474 1:199393513-199393535 TCCCTTAAGGATAGCACTGCTGG - Intergenic
921405021 1:214769227-214769249 TCACTCCATGACCACACTGTTGG - Intergenic
1065039714 10:21679941-21679963 TCCCTTATGGCTAACACTGTTGG - Intronic
1065175019 10:23067688-23067710 GCCCTTTAGAATCACACTGCCGG - Intergenic
1068175499 10:53451990-53452012 TCCCTTTACGGTCACACTTTAGG - Intergenic
1068398031 10:56489299-56489321 TCCCTTAAATTTCACACTGTAGG + Intergenic
1069718250 10:70534296-70534318 TTCCTTCTGAATCACATTGTGGG - Intronic
1071138807 10:82482849-82482871 TACCTACAGGATTACAGTGTGGG + Intronic
1071563860 10:86661707-86661729 TTTCTTCAGGATGACACTGTCGG - Intronic
1072929919 10:99653246-99653268 TCTCTTTAGGATCACCCTGGGGG + Intergenic
1073296183 10:102440266-102440288 TCCCTGCAGCCTCACACTCTTGG - Intergenic
1074344183 10:112665634-112665656 TTCCTTCAGTAGCAGACTGTAGG + Intronic
1076201957 10:128566254-128566276 TCCCTCCAGGAGCACACCCTAGG + Intergenic
1078315370 11:10289561-10289583 TGCCTCCAGGAGCAGACTGTGGG + Intronic
1081219518 11:40442616-40442638 TCCCTGGAGAATCACACTTTAGG - Intronic
1083744706 11:64728957-64728979 CCCCTCCAGGCTCACACTCTGGG + Exonic
1086157029 11:83678662-83678684 TCCCTTCTGGATCACATTCAGGG - Intronic
1086848437 11:91780338-91780360 TACTTGGAGGATCACACTGTAGG - Intergenic
1091694831 12:2621459-2621481 GCCCTTCAGGATCACGGTGAGGG + Intronic
1095273097 12:40244702-40244724 TCCCTTGAACATCACACTCTGGG + Intronic
1098514220 12:71355055-71355077 TCCCTTGAGAATCAGTCTGTCGG - Intronic
1098677068 12:73302981-73303003 TCCCTTGAGGACATCACTGTGGG + Intergenic
1102519183 12:113468389-113468411 TCCGTACAGGATGACACTGCGGG + Exonic
1103134781 12:118498075-118498097 TCCCTTCCAGATCACACTTAAGG + Intergenic
1106233125 13:27837988-27838010 TCCTTTATGGATCACACTTTTGG + Intergenic
1107727954 13:43318952-43318974 TCCCTCCAGGTTGACTCTGTGGG - Intronic
1110243231 13:73291818-73291840 TACCTCCATCATCACACTGTTGG - Intergenic
1111858489 13:93670993-93671015 TCCATTCATTTTCACACTGTTGG + Intronic
1114190778 14:20438051-20438073 TACCTTCAGGAGTTCACTGTGGG - Intergenic
1115867617 14:37765425-37765447 GCACTTCAGGATCACAAAGTTGG - Intronic
1115978809 14:39026504-39026526 TCCCTTCACAATATCACTGTTGG - Intergenic
1116770880 14:49125625-49125647 TCCCCTCAGCACCAGACTGTGGG - Intergenic
1118442725 14:65826933-65826955 TATCTTCAGGATCCCACTGAAGG + Intergenic
1121699998 14:95945439-95945461 TCCCTTCAGAAAGACACTGGAGG - Intergenic
1124642920 15:31408421-31408443 TCTCATAAGGATGACACTGTTGG - Intronic
1128452057 15:67811428-67811450 TCCCTTCTGAACCACCCTGTGGG - Intergenic
1129591060 15:76915600-76915622 TGCATTCAGGAGCTCACTGTTGG - Intergenic
1132146405 15:99432363-99432385 CCCCATCAGGATCCCGCTGTGGG - Intergenic
1134228115 16:12407903-12407925 TCCCTGCAGGCTCAAACTGCTGG - Intronic
1134776042 16:16854613-16854635 TCCCTTCATGATCACACCTTTGG + Intergenic
1135153448 16:20031172-20031194 TAGCTTCAGAATGACACTGTGGG - Intergenic
1137257552 16:46789610-46789632 TCCCTTCAGCCTCACAGTGCTGG + Intronic
1142619541 17:1156087-1156109 CCCATTGAGGATCACAGTGTTGG - Intronic
1143706199 17:8699127-8699149 TCCCTCCTGGACCACACTGGAGG - Intergenic
1143850993 17:9811888-9811910 TCCCACCAGGATCAGACTGGGGG - Intronic
1144158364 17:12531141-12531163 TCCCATCAGGACCACACTAAAGG - Intergenic
1144330095 17:14215085-14215107 TCCCTTCAGGAAAACGCTTTGGG + Intergenic
1145786058 17:27594608-27594630 GCCCTCCAGGATCCCACTGAAGG + Intronic
1148255635 17:46129235-46129257 TCCCTACAGAATCACAATATTGG + Intronic
1149613031 17:57971661-57971683 TTCATTCAGGAGCACACCGTAGG + Intronic
1152987146 18:331256-331278 TCCCTTCAGGATCACACTGTGGG - Intronic
1153028332 18:690838-690860 TGGCTTTAGGATTACACTGTAGG - Intronic
1155633973 18:27928939-27928961 TTGCTTCAGGAACACACAGTTGG - Intergenic
1158757516 18:60344546-60344568 TCCCCATAGGATCTCACTGTTGG + Intergenic
1158840993 18:61387203-61387225 TGCCATCAGGACCACATTGTTGG - Intronic
1159016648 18:63106311-63106333 TCCCCTCAGCAGCACACTCTGGG - Intergenic
1160402511 18:78621262-78621284 TCCCATCAGACTCACACTGCAGG + Intergenic
1163381755 19:16973722-16973744 GCCCTTCAGGGTCACACCTTAGG - Intronic
1163415354 19:17183242-17183264 TCCTTTCAGGATCATGCTGGTGG - Intronic
1165102121 19:33445066-33445088 TCCATCCAGCATCACACTGTGGG - Intronic
1167605436 19:50479324-50479346 CCCCTGCAGGTTCACACAGTCGG + Intronic
1167674861 19:50877780-50877802 TCCCTTTGGGATCAGACTGCAGG + Intronic
925333287 2:3075148-3075170 TCCCTTCCGTATCACAGTGAGGG + Intergenic
927050777 2:19326147-19326169 TCCCTTAAGGATTATACAGTGGG + Intergenic
930699427 2:54444633-54444655 TTCCTGCTGGATCACACTGCTGG - Intergenic
935285873 2:101563220-101563242 TCCCTTCATGAGCTCACTTTAGG + Intergenic
936069317 2:109354686-109354708 TCCCTTTAGGATGCCACTGGAGG - Intronic
937085972 2:119172045-119172067 TCCCTTTGGGATTACACTTTGGG + Intergenic
937488109 2:122336927-122336949 TCCCTTAAGGTACACAGTGTAGG - Intergenic
939699494 2:145372591-145372613 TCCTTTCAAGATCACACAGCTGG + Intergenic
941317998 2:164018830-164018852 TGCCATCAGGAGCTCACTGTCGG + Intergenic
943700608 2:190985151-190985173 CTCCTTAAGGATCACGCTGTAGG + Intronic
945979680 2:216299060-216299082 TCTTTTCAGGATCACAGTGGTGG - Intronic
946430551 2:219624982-219625004 CCCCATCGGGAACACACTGTAGG + Intergenic
948389550 2:237602102-237602124 TTCCTCCAGGACCACACTGATGG + Intergenic
1170303542 20:14912845-14912867 ACCTGTCAGGATCTCACTGTGGG + Intronic
1171456690 20:25276431-25276453 TCCTCTCAGGATGACAATGTGGG + Intronic
1175729646 20:61345697-61345719 TCCATTCAGGATCTCAGTGCAGG - Intronic
1176034597 20:63030033-63030055 GCCCTTCAGGACCCCTCTGTGGG + Intergenic
1179308428 21:40175724-40175746 ACCCTTCAGAATTTCACTGTGGG + Intronic
1180987657 22:19914883-19914905 TCCCTTCAGCCTCAGAATGTTGG - Intronic
1182300886 22:29336287-29336309 TCCCTTCAGAATCACTCAGTAGG - Intronic
1183234950 22:36610120-36610142 TTCCTGCCGGATCACACTCTGGG - Intronic
949365933 3:3280505-3280527 TTCCTTCATGATCCCACTCTTGG + Intergenic
949469943 3:4383713-4383735 TCCCATAAGGATGACACAGTAGG - Intronic
950658399 3:14451634-14451656 TTCCTTAAGGAACACACTGGTGG + Intronic
951097593 3:18649937-18649959 TGACTTCAGGAGCACACTCTGGG + Intergenic
956009550 3:64816156-64816178 TCACTTCAGGCTCCCACTCTTGG + Intergenic
961055042 3:123780611-123780633 CTCCTTCCAGATCACACTGTTGG + Intronic
961693018 3:128684089-128684111 TCCCTTCAACTTCTCACTGTAGG - Intergenic
967453700 3:189655836-189655858 ACCCATCAGGTTCTCACTGTAGG + Intronic
969327474 4:6452234-6452256 TCCCTTCAGGGTGACACCGCAGG + Intronic
972657521 4:41079095-41079117 TCTCTTCAGGATCAGACACTTGG - Intronic
978846699 4:113281605-113281627 TCCCTTCAGCATGTCACTGAAGG + Intronic
978973759 4:114843484-114843506 CCCCTTCAAAATCACACTTTTGG + Intronic
979548720 4:121965853-121965875 TCCCTTCAGGATGTTACTCTTGG + Intergenic
981752413 4:148105086-148105108 TTCCCTCAGGATCACACTAGAGG - Intronic
982689030 4:158527667-158527689 TTACTTGAGGATCAGACTGTGGG - Intronic
984560981 4:181269815-181269837 TCCCCTGTGGACCACACTGTGGG - Intergenic
985929665 5:3047161-3047183 TCCCTTCAGGGAGTCACTGTGGG + Intergenic
986702566 5:10425302-10425324 TCCCTTCAGGATCAGAGTGCAGG + Intronic
989465316 5:41748019-41748041 TCCTTTCTGTAGCACACTGTTGG + Intronic
991399384 5:66237268-66237290 GCCCATCAGGAGCTCACTGTGGG - Intergenic
991501558 5:67282176-67282198 TTCTTTCAGGATGGCACTGTAGG - Intergenic
994910198 5:105895225-105895247 TCCCTTCAGGAGAGCAGTGTAGG + Intergenic
996142061 5:119923762-119923784 GCCCTTGAGGATCTGACTGTCGG + Intergenic
997571972 5:134936492-134936514 TGCTTTCAGGAACAGACTGTTGG + Intronic
998051976 5:139043422-139043444 TCAGTTCAGGCACACACTGTGGG - Intronic
1001781271 5:174371043-174371065 TCCCTTCAGGATCACATCTCAGG + Intergenic
1002174110 5:177391681-177391703 CCCGTTCAGGATCACATGGTTGG - Intronic
1002774392 6:316264-316286 GCCCTTCAGGACTACACTTTTGG + Intronic
1003518257 6:6835654-6835676 TCCCTTCAAAATGCCACTGTAGG - Intergenic
1005195022 6:23272246-23272268 TCCCTCCAGGATCTCAGTTTTGG + Intergenic
1006190059 6:32202119-32202141 ACTCTTCAGAGTCACACTGTGGG + Exonic
1012324300 6:97895889-97895911 TCTCTTCATGATCCCACTTTGGG - Intergenic
1012651163 6:101755042-101755064 TGCTTTCAGGATCAACCTGTTGG - Intronic
1015241568 6:131029862-131029884 TCCCTTGAGGATTCCATTGTTGG - Intronic
1017350328 6:153433495-153433517 TCTCTTCAGAATCACTCTGTCGG - Intergenic
1017594880 6:156017649-156017671 GCCCTGCAGGAGCCCACTGTTGG + Intergenic
1018304866 6:162444363-162444385 TCCTTTAAGTCTCACACTGTCGG + Intronic
1020561179 7:9729641-9729663 GCCCTTCAGGGTCACACCTTAGG + Intergenic
1024794491 7:53004979-53005001 TCCCAGCAGGTTCACACTGCTGG - Intergenic
1024855645 7:53775542-53775564 TACCTTCAGGATGATTCTGTGGG - Intergenic
1025985713 7:66449577-66449599 TCCCTCCAGGAGCCCAATGTGGG + Intergenic
1026002560 7:66572879-66572901 TCCCTCCAGGAGCCCAATGTGGG + Intergenic
1028433802 7:90778472-90778494 TTCCTGCAGGAGCACACAGTGGG - Intronic
1032125040 7:129187876-129187898 TCCTTTGAGCATCACACTTTTGG - Intergenic
1034956318 7:155337596-155337618 CCCCCTCAGGAGCACACTTTGGG - Intergenic
1035103605 7:156421771-156421793 TCCCTTCAGGATTTTCCTGTTGG - Intergenic
1036171517 8:6489983-6490005 GCCTTCAAGGATCACACTGTTGG + Intronic
1038685775 8:29717040-29717062 TCTTTTAAGGATCACACTTTTGG - Intergenic
1038869471 8:31478836-31478858 TTCCTTCCTGCTCACACTGTGGG + Intergenic
1039217263 8:35286354-35286376 TTCCTACAGTATGACACTGTTGG - Intronic
1045363318 8:101452858-101452880 TCTCTTCAAGTTCACTCTGTTGG + Intergenic
1046883677 8:119339166-119339188 ACTCTAGAGGATCACACTGTTGG + Intergenic
1047862652 8:128985326-128985348 TCCCATCAGGCTCCCACTATTGG + Intergenic
1047960438 8:130007882-130007904 TCCCATCAGGATCACGTCGTGGG - Intronic
1048306819 8:133290200-133290222 CCCCTTCAGCCTCACCCTGTGGG - Intronic
1049200391 8:141337208-141337230 TCCCTGCAGGATGACAGGGTGGG - Intergenic
1051095563 9:13461795-13461817 TCCTGGCAGGATCACAGTGTTGG + Intergenic
1053478794 9:38400965-38400987 TCCCTGCAGGAGCTCACAGTTGG + Intergenic
1055763058 9:79630622-79630644 TCTCTGCGAGATCACACTGTTGG + Intronic
1056031071 9:82553959-82553981 TCCTTTCAGGATCACTCAGAAGG + Intergenic
1057877779 9:98771097-98771119 GCCGTGCAGGATCACAGTGTGGG + Intronic
1059147156 9:111910341-111910363 GCACTTAAGGATCACACAGTGGG + Intronic
1187163150 X:16782799-16782821 TTCCTTCAGGATAATACTCTAGG + Intergenic
1188546771 X:31316146-31316168 TCCCTTAAGCACCAAACTGTAGG + Intronic
1189756212 X:44274215-44274237 TCCCTTCAGGATGGCACCTTTGG + Intronic
1192358334 X:70423534-70423556 TCCCTTCAGGAGCTGCCTGTAGG - Intronic
1199480236 X:148290193-148290215 TGCCTTCAGGATGACATTCTTGG + Intergenic
1200709451 Y:6470433-6470455 TCCCATGAGGGTCACACTTTGGG + Intergenic
1201024661 Y:9694275-9694297 TCCCATGAGGGTCACACTTTGGG - Intergenic