ID: 1152988463

View in Genome Browser
Species Human (GRCh38)
Location 18:340877-340899
Sequence CTGTGGACAAGGTGCTTCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 180}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152988463_1152988470 20 Left 1152988463 18:340877-340899 CCTTGGAAGCACCTTGTCCACAG 0: 1
1: 0
2: 1
3: 13
4: 180
Right 1152988470 18:340920-340942 TGTTTCTTGCCAATTGTCCATGG 0: 1
1: 0
2: 0
3: 16
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152988463 Original CRISPR CTGTGGACAAGGTGCTTCCA AGG (reversed) Intronic
901530715 1:9850893-9850915 CTGAGGACAAAGTACTTCCGAGG + Intronic
903231450 1:21924787-21924809 ATGTGGACAATGTGAGTCCAGGG + Intronic
903610873 1:24611382-24611404 CTGTAGACAAGGTCGTTCTAGGG - Intergenic
903690937 1:25173141-25173163 CTGTGTGCAAGGTGCTGACATGG + Intergenic
907799346 1:57749487-57749509 CTGTGGACCTGGTGTTGCCAAGG - Intronic
909423539 1:75494361-75494383 GTGTGGTCCAGGTTCTTCCAGGG - Intronic
910349294 1:86277521-86277543 CTGTGGCCAAGCTGTTACCAAGG + Intergenic
912374280 1:109197805-109197827 CTGTGTGCAAAGTGCTCCCAGGG + Intronic
915219425 1:154362480-154362502 CTGAGGACAAGGTGGTCCCAAGG - Intergenic
916993859 1:170274547-170274569 CGGTGGCCAAGGTCCTACCAAGG + Intergenic
918140602 1:181716473-181716495 CTGAGGACCTGTTGCTTCCAGGG + Intronic
918279861 1:182993910-182993932 CTGTGAAGAAGCTTCTTCCAAGG - Intergenic
920126858 1:203700367-203700389 CTGTGGCCTAGGTGTTTGCAGGG - Intronic
921662623 1:217823508-217823530 CTGTGGACAAGGAAATGCCATGG + Intronic
923429837 1:233909382-233909404 CTGTGGCCCAGGTGCTTTCTGGG - Intronic
923511792 1:234659484-234659506 CAGTGGACTAGCTGCTCCCAGGG + Intergenic
924248237 1:242106106-242106128 CTGTGGACCAGGAACTGCCATGG + Intronic
1063964128 10:11332634-11332656 CTGAGGCCAAGAAGCTTCCAGGG - Exonic
1065997096 10:31069439-31069461 CTGAGGTCAGGGTGCTTCCCGGG - Intergenic
1067794755 10:49312727-49312749 CTGTTGACAAGCTGGCTCCAGGG - Intronic
1068234694 10:54218616-54218638 CTGAGATCAAGGTGCTTTCATGG - Intronic
1068732680 10:60376523-60376545 CTGAAGACAAGGCTCTTCCATGG + Intronic
1069943149 10:71969117-71969139 CTGTGGACCAGGTGCTGCTGAGG - Intronic
1070643521 10:78185798-78185820 CTGGGGACACTGTGATTCCATGG + Intergenic
1070820926 10:79353844-79353866 CTGTGGCCAGGGTGCTGGCATGG + Exonic
1070976791 10:80611727-80611749 CAGTGGAGAAGGTGCGACCAAGG + Intronic
1074370699 10:112898766-112898788 CTTGGGGAAAGGTGCTTCCAGGG + Intergenic
1076159948 10:128236015-128236037 CAGTGGGCAAGGTGCTAGCATGG + Intergenic
1078014389 11:7600677-7600699 CTGTAGATAAGGTGCTTCCTCGG + Intronic
1079175472 11:18136325-18136347 CTGTGTACAAAATGCTTCTAGGG + Intronic
1079266232 11:18935641-18935663 CTGTGTACAAAATGCTTCTAGGG - Intronic
1079779509 11:24583006-24583028 ATGTTAACAAGGTGCTTTCATGG + Intronic
1080394055 11:31873813-31873835 CAGTGGGGAAGGTACTTCCAGGG + Intronic
1080610498 11:33899974-33899996 CCGTGGAAATGGTGCCTCCAAGG - Intergenic
1084718006 11:70885712-70885734 CTGTGTACATGGTGCTCCCGGGG - Intronic
1084885917 11:72206798-72206820 GTGTGGACAAACTCCTTCCAGGG - Intergenic
1085734616 11:79028590-79028612 CTGGTGACAAGCTGCCTCCAGGG + Intronic
1086383457 11:86284088-86284110 CTGAGGAAAAGCAGCTTCCACGG + Intergenic
1087435192 11:98107413-98107435 CTGTAGACAAAGTGTTTTCAAGG + Intergenic
1090028113 11:123184970-123184992 GTGTGGACAAGGTGCTCTCGGGG + Intronic
1090615900 11:128514673-128514695 CTGGGTTCCAGGTGCTTCCATGG - Intronic
1092296916 12:7208097-7208119 GTGTGGGTGAGGTGCTTCCAAGG + Intronic
1094438888 12:30453005-30453027 GGGTGGACAAGGTGCTTCCATGG - Intergenic
1096678992 12:53242336-53242358 CTGTGGCCAAGGGGCTGCCTGGG + Intergenic
1096761234 12:53843740-53843762 CTGTGGACCTGGTGTTTCAAAGG - Intergenic
1097708945 12:62897554-62897576 GTGTGGACAAGGTTCTTACAGGG - Intronic
1101715804 12:107310974-107310996 GTGTTGAGAGGGTGCTTCCAGGG + Intergenic
1104001420 12:124863248-124863270 GTGTGGACAGGTTGCTTCCGTGG - Intronic
1106447718 13:29850852-29850874 CTTTGGACAAGCTGCTGCCCAGG + Intergenic
1108260640 13:48652168-48652190 CTGAAGACAAGGTTCTTCCTGGG - Intergenic
1109792734 13:67270616-67270638 CTGTGGACTAGGTGGATTCAGGG + Intergenic
1113437565 13:110305730-110305752 CAGTGGAGAAGCTGCCTCCAGGG + Intronic
1115473086 14:33788760-33788782 CTGTGGACAAAGTTTTCCCAAGG + Intronic
1121010184 14:90515491-90515513 CTGTGTATAAAGTGCTTCGAGGG + Intergenic
1122740981 14:103871604-103871626 CTGGGGAGAAGGTGCTCCCTGGG + Intergenic
1122837605 14:104437746-104437768 CTGTGGTCTGGGGGCTTCCAGGG - Intergenic
1122978043 14:105179026-105179048 CTGTGGGCAGGGGGCTTCCCTGG - Intronic
1123164736 14:106315456-106315478 CTGGGCACAAGGTGTTTCCCTGG - Intergenic
1202885133 14_KI270722v1_random:98734-98756 GTGTGGATGAGTTGCTTCCACGG - Intergenic
1129200899 15:73998561-73998583 CTGAGGACAAGGAGCTTCTGGGG + Intronic
1129592925 15:76932937-76932959 ATGTGGACAAGATGATCCCAAGG - Intronic
1129913306 15:79245876-79245898 CTGAGGAAAAGCTGCTGCCAAGG + Intergenic
1130014721 15:80177696-80177718 CTGTGGGCCTGGAGCTTCCATGG + Intronic
1130661316 15:85833558-85833580 ATGTGAACAAGGTGCTTTCCTGG - Intergenic
1131145377 15:90007872-90007894 CTATTCACAAGGTGCTTCCTTGG - Intronic
1134132472 16:11659077-11659099 CTTTGCACAAGCTGCTCCCAAGG - Intergenic
1134844081 16:17425157-17425179 CTGTTTACGAGGTGCTTCAAGGG - Intronic
1137436228 16:48455987-48456009 CTTTGGAGAAAGTTCTTCCATGG + Intergenic
1141522502 16:84590385-84590407 CTCTGCACATGGTGCTCCCAGGG - Intronic
1141746599 16:85930475-85930497 CTGTGGACAGGGGACTTCCTTGG - Intergenic
1142934057 17:3312421-3312443 CTCTGAAGAAGGTGCTTGCAGGG - Intergenic
1144663414 17:17086273-17086295 GTGTTGAGAAGGTTCTTCCAGGG + Intronic
1145993785 17:29094224-29094246 CTCTGGAGAAGCTGCTGCCACGG - Intronic
1146674405 17:34763293-34763315 CTGTGGACACGGTGTGGCCATGG + Intergenic
1147191664 17:38741533-38741555 CTGTGTCCATGGTGTTTCCAGGG - Intronic
1148190349 17:45674436-45674458 CTGTGGAGAATCTGCTTCTATGG + Intergenic
1152988463 18:340877-340899 CTGTGGACAAGGTGCTTCCAAGG - Intronic
1153493625 18:5675264-5675286 CTGTGTTAAAGGTGGTTCCAAGG - Intergenic
1153665722 18:7366508-7366530 CCCTGGACAAAGTGCTTCCCAGG + Intergenic
1155361517 18:25007654-25007676 TTGTGGCCAGGGTGCCTCCACGG + Intergenic
1157628029 18:49067865-49067887 CTGAGGACATGGTCCCTCCAAGG + Intronic
1159232468 18:65627223-65627245 CTGTAGACACAGTGCATCCATGG + Intergenic
1160100897 18:75918125-75918147 CTGTGGACCAGGGGCTCTCAAGG + Intergenic
1160420733 18:78742235-78742257 AGGTGGACAAGGTGCTTCACTGG - Intergenic
1161156099 19:2732612-2732634 CTGTGCACAAGGGGCCTCCCGGG - Exonic
1163193555 19:15697335-15697357 CTGTGGACAATGTGGAGCCATGG + Intergenic
1164911649 19:32017327-32017349 CTGTGGGCCAAGTGCTTTCATGG - Intergenic
1165824670 19:38698939-38698961 CGGAGGACAAGGGGCTTCTACGG - Intronic
1168524904 19:57081035-57081057 CTGTGGATGAGGTGGTTCCAGGG + Intergenic
1202660538 1_KI270708v1_random:65765-65787 GTGTGGATGAGTTGCTTCCACGG - Intergenic
925832606 2:7910814-7910836 CTATCCACAAGGTGCTTCCTGGG + Intergenic
927461941 2:23306848-23306870 CTGTGGACAAGGTGACTCCTAGG - Intergenic
928024140 2:27726306-27726328 CTGTGGCCAAGGGGCTCCTAGGG + Intergenic
928906759 2:36376659-36376681 CTCTGGAGTTGGTGCTTCCAAGG + Intronic
930092742 2:47543153-47543175 CTGTGAATAAGGAGCTACCAGGG + Intronic
934011771 2:87826969-87826991 CTGTGGAAATGATGCTTGCAGGG + Intergenic
935206777 2:100903129-100903151 CTGTGGACAAGCTCTGTCCAGGG + Intronic
937038247 2:118800365-118800387 CTGTGGACAAGTTACTTGCCTGG + Intergenic
940846754 2:158650659-158650681 CTGAGGGCAAGATGCTTCCTAGG - Intronic
941659749 2:168183685-168183707 CTATGGACAGGTTGCTTCAAAGG + Intronic
945191898 2:207197199-207197221 ATGTAGACAAGTTGTTTCCATGG - Intergenic
947076746 2:226353279-226353301 CTGTTGGCAGGGTGCTTCCTTGG + Intergenic
1172273967 20:33669854-33669876 CTGTGGACAGAGTCCTTGCAGGG + Intronic
1173754990 20:45508184-45508206 ATGGGCACAAGGTTCTTCCATGG - Intergenic
1174282225 20:49447505-49447527 CTGTGTGCTAGGTGCTTCCCAGG - Intronic
1175705587 20:61174302-61174324 CTGTGGGGCAGGTTCTTCCAGGG + Intergenic
1176240204 20:64072413-64072435 CTGTGGACAAGGCCCCTCCCTGG + Intergenic
1178341958 21:31793311-31793333 CTGTGGATAAGATGCTTACATGG + Intergenic
1179422574 21:41248400-41248422 AGGTGGACAAGGAGGTTCCAAGG - Intronic
1179722147 21:43321949-43321971 CTGTCTTCAGGGTGCTTCCAAGG + Intergenic
1179774970 21:43655918-43655940 CTCTAGAAAAGGTGCATCCAGGG - Intronic
1180328021 22:11449353-11449375 GTGTGGATGAGTTGCTTCCACGG - Intergenic
1181159156 22:20946903-20946925 CTATGGACCAGCTTCTTCCATGG - Intronic
1184892011 22:47385816-47385838 CTGTAGTCAAGGTGCTTCTCAGG - Intergenic
950913165 3:16616189-16616211 CAGTGGAGAAGATGTTTCCAGGG + Intronic
951333166 3:21389754-21389776 CTTTGGAAGAGGTTCTTCCATGG + Intergenic
952666779 3:35916333-35916355 CTGTGTCCATGTTGCTTCCAAGG + Intergenic
953730483 3:45443186-45443208 CTGTAGACAAGGGTCTTCTAGGG - Intronic
957436449 3:80183003-80183025 ATGTGGACCAGGTGGCTCCAGGG - Intergenic
959976686 3:112468591-112468613 CTGTGGACATTGTTCTTCCTGGG - Intronic
961174077 3:124819927-124819949 CTAAGGAAAAGGTGCTTCCCTGG - Intronic
965507504 3:169532624-169532646 CAGTGGTCTAGGTGCTCCCAGGG - Intronic
966124239 3:176556801-176556823 CTGTGGGAATGGTGCTCCCAAGG - Intergenic
968524916 4:1051696-1051718 CTGTGGACGTGGTGCTTGGATGG + Intergenic
968526100 4:1058225-1058247 CTGTGAAGAAGGTGCTTGCGGGG + Intronic
968526105 4:1058257-1058279 CTGTGAAGAAGGTGCTTGCGGGG + Intronic
968546405 4:1201086-1201108 ATGTGGGCAGGGTGCATCCATGG - Intronic
969271600 4:6106873-6106895 TGGTGGACAAGCTGCTTCCAGGG + Intronic
971771428 4:30902000-30902022 CTGTGGGCAAGTTTCCTCCACGG + Intronic
972174498 4:36386779-36386801 CTGTGGACATTGTCCTTCCATGG + Intergenic
976231138 4:82844393-82844415 CTGTGGATAAGGTGGTACCTGGG + Exonic
978755445 4:112296872-112296894 CAGTGGACATTGTCCTTCCATGG - Intronic
982470277 4:155781019-155781041 CTGTGGACAGGCAACTTCCAAGG - Intronic
983792599 4:171815250-171815272 CTGTTGCTAAGGTGCTGCCATGG + Intronic
983847114 4:172534028-172534050 CTGTGGAAGAAGTGATTCCAAGG + Intronic
985647757 5:1093149-1093171 CTGTGGCCTCGGTGCTCCCAGGG - Intronic
986264889 5:6182806-6182828 CTGGGGACAAGGTCCTCCCAGGG - Intergenic
987549572 5:19361141-19361163 CTATGAACAAGGTGTTTGCAAGG + Intergenic
990596956 5:57321796-57321818 CAGTGGAAAAGGAGGTTCCAGGG - Intergenic
994766937 5:103930606-103930628 CTGTGGAAAATGTTCTTACATGG - Intergenic
995928926 5:117411703-117411725 CTGTTTTCAAGGTGTTTCCAGGG - Intergenic
1001663393 5:173413162-173413184 GTGTGGAGGAAGTGCTTCCAGGG + Intergenic
1001936331 5:175708450-175708472 CTGTGTACCAGGTGCTTCCCTGG + Intergenic
1004100308 6:12602714-12602736 CTGTAGAAAAGGTGCTTTCATGG + Intergenic
1006631723 6:35435188-35435210 CCTTGGACAAGGTGCCTCCCAGG - Intergenic
1007125350 6:39421640-39421662 CTGTGGACAGGAGGTTTCCAGGG + Intronic
1007585788 6:42988488-42988510 ATATGGACAAGTTGCATCCAAGG + Intronic
1007588489 6:43007278-43007300 ATGTGGCCAAGCAGCTTCCAGGG - Exonic
1009355077 6:62733523-62733545 CTGTGGACAAGGAGATCCAATGG - Intergenic
1009871103 6:69452575-69452597 CAGTGGAGAAGGTGCAGCCAGGG - Intergenic
1011654906 6:89543373-89543395 TTGGGGACAAGGTGCTTCTGTGG + Intronic
1012230134 6:96751345-96751367 CTGTAGAGAGGGTGCTTTCATGG - Intergenic
1015506781 6:133996750-133996772 CTGTGCACAAGCAGGTTCCATGG + Intronic
1017454706 6:154591052-154591074 ATGTGGAGTAGGTGTTTCCAGGG - Intergenic
1019197888 6:170292493-170292515 CTGTGGCCAGGCTGCTTCCTTGG - Intergenic
1019423799 7:963743-963765 CTGTGAACATGGTGCTTACATGG + Intronic
1019800406 7:3084287-3084309 ATGTGGACAAGATGCCACCAAGG + Intergenic
1020141763 7:5615568-5615590 GTGTGGACTAGGTGCTCCCGGGG + Intergenic
1023165495 7:37339299-37339321 CTGTGTACAAGAAGCATCCAGGG - Intronic
1026867616 7:73833214-73833236 CAGTGGACAAGGTGATACCTTGG - Intergenic
1028839507 7:95412721-95412743 TGGTGGACTAGGTGATTCCAGGG + Intronic
1030155532 7:106450775-106450797 CAGTGGACAAGGTGAACCCACGG - Intergenic
1032196333 7:129790998-129791020 CTGTTTACAAAGTGCTTTCATGG + Intergenic
1032451698 7:132037065-132037087 CTGGGGCCAAGATGCCTCCAGGG + Intergenic
1034924562 7:155110777-155110799 CTGGGGAGAAGGTGATTCCCCGG - Intergenic
1036647981 8:10623953-10623975 CTGGGGACATGGTGATGCCAGGG - Intronic
1036802465 8:11802736-11802758 CTGTGGAGTAGGTGCTTCGAGGG - Intronic
1036980672 8:13466591-13466613 ATGTTTACAAGGTGCCTCCATGG - Intronic
1041095358 8:54343981-54344003 CTGTGGACCATGTGCAACCAGGG + Intergenic
1042513123 8:69631738-69631760 CTGTGGGCAAGAGCCTTCCAGGG - Intronic
1043037195 8:75212976-75212998 CTGAGATCAAGGTGCTTTCAGGG + Intergenic
1044013359 8:87021575-87021597 CTATGGACTAAGTGCCTCCAAGG + Intronic
1045683545 8:104688268-104688290 CTCTCCATAAGGTGCTTCCATGG + Intronic
1047535057 8:125712163-125712185 CTGTGTCCCAGGTGCTCCCAGGG + Intergenic
1048866507 8:138765360-138765382 CTTTGGACAAGGTGCACCCTAGG - Intronic
1049320903 8:141995741-141995763 TTGTGGGCAAGGTGGTTCCTTGG + Intergenic
1049470069 8:142771296-142771318 CTGGGGTCCAGGTGCTTCCCAGG - Intronic
1049473967 8:142788372-142788394 CTTGGGGGAAGGTGCTTCCAGGG + Intergenic
1051371160 9:16360376-16360398 TTGGGGAGGAGGTGCTTCCATGG - Intergenic
1054944282 9:70778518-70778540 GTCTGTACAAGGTGTTTCCAAGG + Intronic
1057910761 9:99018423-99018445 ATGTGGACAAAGAGCTTCCCAGG - Intronic
1059567282 9:115395601-115395623 CTGTGGACAAACTGATTTCAGGG - Intronic
1060423018 9:123483043-123483065 CAGTGGACACAGTGCTTCCTTGG - Intronic
1062502182 9:136856338-136856360 AGGTGGACAAGGTCCTTCTAGGG + Intronic
1185615502 X:1419337-1419359 GTGTGGACCAAGTGATTCCAAGG - Intronic
1187039745 X:15580999-15581021 CTGTGGACAATCTGCTTTCTTGG - Intronic
1188390713 X:29615964-29615986 TTGTGGGCAAGGTGCTTTGAAGG + Intronic
1189214158 X:39309044-39309066 CTGAGCACATGGTGCTTCTATGG - Intergenic
1189974559 X:46448179-46448201 CTGTGGTCATTGTGTTTCCAGGG + Exonic
1189984816 X:46544610-46544632 CTGTGGTCATTGTGTTTCCAGGG - Exonic
1192239857 X:69320364-69320386 CTCAGGCCAAGGTGCTCCCAGGG - Intergenic
1197719128 X:129733088-129733110 CTGAGGCCAAGGTGGTTTCATGG + Intergenic
1199132713 X:144211578-144211600 CTGTGGAAATGATGCTTGCAGGG - Intergenic
1199848343 X:151707634-151707656 CTGAGGTCAAGGTGCTGGCAGGG + Intergenic
1200135521 X:153872795-153872817 CTGTGGCCATGGGGCCTCCAGGG - Intronic