ID: 1152990498

View in Genome Browser
Species Human (GRCh38)
Location 18:359317-359339
Sequence CTAGTTTACCGGCATGCCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 52
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 45}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152990495_1152990498 -8 Left 1152990495 18:359302-359324 CCTGGCCGCAAACAACTAGTTTA 0: 1
1: 0
2: 0
3: 13
4: 98
Right 1152990498 18:359317-359339 CTAGTTTACCGGCATGCCACTGG 0: 1
1: 0
2: 1
3: 5
4: 45
1152990491_1152990498 0 Left 1152990491 18:359294-359316 CCCCATTCCCTGGCCGCAAACAA 0: 1
1: 0
2: 0
3: 22
4: 169
Right 1152990498 18:359317-359339 CTAGTTTACCGGCATGCCACTGG 0: 1
1: 0
2: 1
3: 5
4: 45
1152990493_1152990498 -2 Left 1152990493 18:359296-359318 CCATTCCCTGGCCGCAAACAACT 0: 1
1: 0
2: 0
3: 6
4: 143
Right 1152990498 18:359317-359339 CTAGTTTACCGGCATGCCACTGG 0: 1
1: 0
2: 1
3: 5
4: 45
1152990492_1152990498 -1 Left 1152990492 18:359295-359317 CCCATTCCCTGGCCGCAAACAAC 0: 1
1: 0
2: 0
3: 6
4: 105
Right 1152990498 18:359317-359339 CTAGTTTACCGGCATGCCACTGG 0: 1
1: 0
2: 1
3: 5
4: 45
1152990494_1152990498 -7 Left 1152990494 18:359301-359323 CCCTGGCCGCAAACAACTAGTTT 0: 1
1: 0
2: 0
3: 2
4: 72
Right 1152990498 18:359317-359339 CTAGTTTACCGGCATGCCACTGG 0: 1
1: 0
2: 1
3: 5
4: 45
1152990490_1152990498 1 Left 1152990490 18:359293-359315 CCCCCATTCCCTGGCCGCAAACA 0: 1
1: 0
2: 0
3: 23
4: 301
Right 1152990498 18:359317-359339 CTAGTTTACCGGCATGCCACTGG 0: 1
1: 0
2: 1
3: 5
4: 45
1152990488_1152990498 17 Left 1152990488 18:359277-359299 CCGCGAATTAGGATGGCCCCCAT 0: 1
1: 0
2: 0
3: 4
4: 27
Right 1152990498 18:359317-359339 CTAGTTTACCGGCATGCCACTGG 0: 1
1: 0
2: 1
3: 5
4: 45

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152990498 Original CRISPR CTAGTTTACCGGCATGCCAC TGG Intronic
911439193 1:97904132-97904154 CTAGTTTACCATCATATCACTGG + Intronic
915078847 1:153337453-153337475 CTAGTTTACCAGCACTCCATTGG - Intronic
1084212125 11:67629164-67629186 CTAGTTTACTGGGAGGCCCCAGG + Intronic
1087725935 11:101716589-101716611 CTATTTTACAGGCATCCAACTGG + Intronic
1093741060 12:22689681-22689703 CTAATTTACAGGGATACCACTGG - Exonic
1095928587 12:47604169-47604191 CTGGTTTACCAGCACACCACTGG - Intergenic
1099187940 12:79536061-79536083 CCAGTTTACCAGCCTGCGACTGG + Intergenic
1107571671 13:41666653-41666675 CTAGTTTACTAGCACGCCACCGG + Intronic
1109919082 13:69032026-69032048 CTAGTTTACAGTCCTGCCAACGG - Intergenic
1114382673 14:22224557-22224579 GTAGGTAACCTGCATGCCACGGG + Intergenic
1118505264 14:66404124-66404146 CTAGCTTAGCAGCATGGCACTGG + Intergenic
1124646713 15:31442029-31442051 CTAGTTCACATGAATGCCACTGG + Intergenic
1126539721 15:49808474-49808496 CTGGTTTACCAGCACACCACTGG + Intergenic
1133730914 16:8577854-8577876 GGAGATTACAGGCATGCCACCGG + Intronic
1136784046 16:32924466-32924488 CTGGTTTAAAGGCATGGCACAGG + Intergenic
1136885736 16:33929340-33929362 CTGGTTTAAAGGCATGGCACAGG - Intergenic
1137228032 16:46533851-46533873 TTATTTTACTGCCATGCCACTGG + Intergenic
1137570761 16:49564913-49564935 CTAAATTCCCGGCATTCCACGGG + Intronic
1138042781 16:53692070-53692092 CTGGTTTACAGGAATGCCCCAGG - Exonic
1203086701 16_KI270728v1_random:1188468-1188490 CTGGTTTAAAGGCATGGCACAGG + Intergenic
1150480594 17:65506021-65506043 TTGGTTTACCAGCATACCACTGG - Intergenic
1151781719 17:76251099-76251121 CCAGTTTACCAGCATACCCCTGG + Intergenic
1152990498 18:359317-359339 CTAGTTTACCGGCATGCCACTGG + Intronic
1153265291 18:3262775-3262797 CTCGGTTACCGGCATGCTAATGG - Exonic
929299685 2:40288732-40288754 CTAGTTTACCAGCACACCAGTGG + Intronic
936783428 2:116062705-116062727 CTAGTCTACCTGCATCCCACAGG + Intergenic
937026964 2:118706806-118706828 CTAGTTTGCTGGCATGTCTCTGG + Intergenic
942943974 2:181653301-181653323 CTAGTTTACAATCATACCACCGG - Intronic
1169095685 20:2896483-2896505 CTAGTTTACCCAGATTCCACAGG + Intronic
1169733228 20:8809573-8809595 ATCATTTACCGGCATACCACTGG + Intronic
956057887 3:65319994-65320016 CTTGCTTACAGGGATGCCACTGG - Intergenic
960824655 3:121770265-121770287 CTAGTCTACCAGCATGCCAGAGG + Exonic
968980551 4:3846884-3846906 CTAAGTTACAGGCATCCCACCGG - Intergenic
986950559 5:13079001-13079023 CTATTTTACCTGTATTCCACAGG + Intergenic
994499079 5:100551414-100551436 TTTGCTTACAGGCATGCCACTGG + Intronic
997634799 5:135397350-135397372 CTAGTATACAACCATGCCACTGG - Intronic
1005632393 6:27720833-27720855 CTATTTGACCGGAAGGCCACAGG - Intergenic
1005662433 6:28012402-28012424 CTAGTCTACCAGCATGCCAGAGG - Intergenic
1010549820 6:77207891-77207913 CTAGTTTCTTGGCCTGCCACAGG - Intergenic
1013738581 6:113256984-113257006 CTGGTTTACCAGCATACCACTGG + Intergenic
1026844908 7:73693369-73693391 GTAGTCTACCACCATGCCACCGG - Exonic
1037922522 8:22817431-22817453 CTGGGTTACCAGCATACCACTGG + Intronic
1042956814 8:74259932-74259954 CTACTTCACCAGCATGCCAGTGG - Intronic
1043429016 8:80176536-80176558 CTAGTTTTCCAGAATGCCAATGG + Intronic
1045884964 8:107084769-107084791 CTTGTTTACCAGAATGCCAATGG + Intergenic
1051290625 9:15542063-15542085 CTAGTTTACTAGCATGCCACTGG + Intergenic
1059731451 9:117061012-117061034 TCAGTTTACCAGCATACCACTGG + Intronic
1193746240 X:85285194-85285216 CTAGTTTACAGTCCTGCCAACGG - Intronic
1197163236 X:123346931-123346953 CCAGTTTTCCAGCATACCACTGG - Intronic
1199208628 X:145179600-145179622 CTAGTTCACCTGAATACCACAGG + Intergenic
1199226321 X:145378912-145378934 CTAGTTTATAGGCATGTCTCTGG - Intergenic
1201866979 Y:18666602-18666624 ACAGTTCAGCGGCATGCCACAGG + Intergenic