ID: 1152991311

View in Genome Browser
Species Human (GRCh38)
Location 18:366286-366308
Sequence ACATTTGAGCAAGAGTTTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 569
Summary {0: 1, 1: 0, 2: 8, 3: 74, 4: 486}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152991308_1152991311 -8 Left 1152991308 18:366271-366293 CCTCTCCGCAGAGTAACATTTGA 0: 1
1: 0
2: 0
3: 4
4: 65
Right 1152991311 18:366286-366308 ACATTTGAGCAAGAGTTTGAGGG 0: 1
1: 0
2: 8
3: 74
4: 486
1152991307_1152991311 -7 Left 1152991307 18:366270-366292 CCCTCTCCGCAGAGTAACATTTG 0: 1
1: 0
2: 0
3: 11
4: 77
Right 1152991311 18:366286-366308 ACATTTGAGCAAGAGTTTGAGGG 0: 1
1: 0
2: 8
3: 74
4: 486

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152991311 Original CRISPR ACATTTGAGCAAGAGTTTGA GGG Intronic
902041651 1:13496904-13496926 GCATTTGAGAAAGGGTCTGACGG + Intronic
902409336 1:16203758-16203780 ACATTTGAGCTGGGTTTTGAAGG - Intronic
904588132 1:31591577-31591599 ACATTTGAGCTGGGTTTTGAAGG - Intergenic
904847197 1:33429499-33429521 ACATTTAAGCAAGGTGTTGAAGG - Intronic
904853457 1:33477184-33477206 ACATTTGAGCTGGTGGTTGAAGG + Intronic
905285808 1:36879638-36879660 ACATTGGAGCAAGGGTTTTCTGG + Intronic
905807640 1:40888381-40888403 ACATTTGAACAGAAATTTGAAGG - Intergenic
906260731 1:44387005-44387027 ACCTAAGAGCTAGAGTTTGAGGG - Intergenic
906693739 1:47810423-47810445 ACATTTGAGAAAAGGTCTGAAGG + Intronic
906750102 1:48251201-48251223 ATAATGGAGCTAGAGTTTGAAGG + Intergenic
906827228 1:48994285-48994307 ACATTTGAACTAGGCTTTGAAGG - Intronic
907264786 1:53251048-53251070 ACATTTGAACAGGATCTTGAAGG - Intronic
907379783 1:54076981-54077003 ACATTTGAGCAGAAACTTGAAGG + Intronic
907526677 1:55057774-55057796 ACATTTGATCGGGAGCTTGATGG + Intronic
907564437 1:55421671-55421693 TCATTTGAACAAGACCTTGAAGG + Intergenic
907650575 1:56291176-56291198 ACATTTGATCAGGCCTTTGAAGG + Intergenic
907898995 1:58720215-58720237 ACATTTGAGGAAAGATTTGAAGG - Intergenic
908170262 1:61497437-61497459 CCATTTGAGCAGGAATTTCAGGG + Intergenic
908190604 1:61699614-61699636 ACATTTGAGCTAGGGTTTGAAGG - Intronic
908351799 1:63293270-63293292 ACATTTGAGCAAAGATTTTAAGG - Intergenic
908447325 1:64212155-64212177 ACATTTGAGCAAAAAATTTAAGG + Intronic
908569734 1:65396557-65396579 ACATTTGAGCAAACACTTGAAGG - Intronic
908577670 1:65478125-65478147 AAATATGTGCAAGAGCTTGAAGG + Intronic
908588196 1:65597504-65597526 ACATTTGAGCAAGGATGTGAAGG + Intronic
909247155 1:73300736-73300758 GCATTTTAGAAAGAGTATGAGGG + Intergenic
909921952 1:81392851-81392873 ATATTAGAGCAAGATTTTGCAGG - Intronic
910345587 1:86232660-86232682 ACATTTGAGCCATGATTTGAAGG - Intergenic
911170343 1:94764782-94764804 ACATTTGAGTAAGGACTTGAAGG - Intergenic
911357048 1:96835509-96835531 ACATTTGAGCAGCATTCTGAAGG + Intergenic
911903153 1:103530355-103530377 ATATTTGAACAACAATTTGAAGG + Intronic
912011637 1:104972485-104972507 AAATATTAGCAAGAGTTTGTGGG - Intergenic
912253733 1:108037898-108037920 ACAGTTGAGCTGGACTTTGAAGG + Intergenic
912677794 1:111701346-111701368 ACATTTGAGCAACCATGTGAGGG - Intronic
912681996 1:111734772-111734794 GCATTTGAACTAGACTTTGAGGG - Intronic
912697642 1:111853480-111853502 ACATTTGAGCAAAAATGTGAAGG - Intronic
913104374 1:115598305-115598327 ATGTTTGAGTTAGAGTTTGAAGG - Intergenic
913688952 1:121260228-121260250 ACATTTGTGCAAAAATTTAAAGG + Intronic
914148648 1:145020049-145020071 ACATTTGTGCAAAAATTTAAAGG - Intronic
914810613 1:151024940-151024962 ACAATTGAGCATGTGTTTAAAGG + Intronic
916247843 1:162706431-162706453 AGATAGGAGCAAGAGTTTGAAGG + Intronic
916296970 1:163229709-163229731 ATATTTGAGTAAAAGTCTGAAGG - Intronic
916511305 1:165474474-165474496 ACATTTGAGCAAAAATTTGAAGG + Intergenic
916522896 1:165581284-165581306 ATACTTGAGCAAGAAGTTGAAGG - Intergenic
916628176 1:166582350-166582372 ACATTTGAGCAAACATCTGAAGG - Intergenic
917139215 1:171818138-171818160 AGGATTGAGCAAGAGTTAGAAGG + Intergenic
917297226 1:173533094-173533116 AGATTTGAGCAATGGCTTGAAGG + Intronic
917880066 1:179326278-179326300 AGATTTGACCTAGAATTTGAAGG - Intronic
917903234 1:179564521-179564543 ACATTTGAGCAAGGTCTTGGAGG + Intronic
917951446 1:180041116-180041138 ACATTTGACCATTATTTTGAAGG + Exonic
918133466 1:181648736-181648758 ATAATTGAGCTACAGTTTGAGGG - Intronic
918888789 1:190235721-190235743 AAATTTGAGCAAAAATTTGAAGG - Intronic
918900059 1:190403845-190403867 ACATTTGTCCAATTGTTTGAAGG - Intronic
919432718 1:197516916-197516938 ACATTTGAGCTGGATGTTGAAGG - Intronic
920476276 1:206278722-206278744 ACATTTGTGCAAAAATTTAAAGG + Intronic
920670300 1:207998970-207998992 GCATTTGAGCAGAAGTTTGAGGG - Intergenic
920703720 1:208236541-208236563 ACCTTTGAGCAGGGGTTAGAGGG - Intronic
920938644 1:210459621-210459643 ACATTTGAGCAAAAACTTGAAGG - Intronic
920977486 1:210799816-210799838 AGATTTGAGCTGGACTTTGAAGG - Intronic
921224623 1:213005913-213005935 ACATTTGAACAAATATTTGAAGG - Intronic
922204118 1:223431810-223431832 GCATTTGAGCAAAGGTTTGAAGG + Intergenic
924137405 1:240983951-240983973 ATGTTTGAGCTAGATTTTGAAGG + Intronic
924330415 1:242935742-242935764 GCATTTGAGCATGGCTTTGAGGG - Intergenic
924396059 1:243622273-243622295 AAATTTCAGCAAGCATTTGAAGG - Intronic
924547133 1:245040038-245040060 ACTTGTGGGCCAGAGTTTGAGGG - Intronic
1063578077 10:7279727-7279749 CCTTTTGTGCAAGGGTTTGATGG + Intronic
1064440710 10:15350970-15350992 ACTTTTGAGCTGGAGTCTGAGGG - Intronic
1065982451 10:30913466-30913488 ACATTTAAGCAAAAATCTGATGG - Intronic
1066213375 10:33262372-33262394 ACATTTGAGCGAAGATTTGAAGG - Intronic
1067841289 10:49681433-49681455 GCATTTGAGTTTGAGTTTGAAGG + Intronic
1068514410 10:58008305-58008327 CCATGTGAGCATGAGTTTGTAGG - Intergenic
1069031085 10:63596990-63597012 AGCTTAAAGCAAGAGTTTGAGGG + Intronic
1069302248 10:66922663-66922685 ACTGTTGAGAAAGAGATTGATGG + Intronic
1069333269 10:67318707-67318729 ACATTTGAGCAAAGGCTTGGAGG - Intronic
1071325739 10:84515242-84515264 ACATTTGCACAAAACTTTGATGG + Exonic
1071959605 10:90797309-90797331 ACATTGGAGCCAGAGCTTCATGG - Intronic
1072044737 10:91643561-91643583 ACATTTGAGCCAGACCTTGAAGG - Intergenic
1072079741 10:92017244-92017266 ACATTTGAGCAAAGATCTGAAGG + Intronic
1072935898 10:99713045-99713067 AAATTTAAGCAAGATATTGATGG - Intronic
1073015666 10:100397188-100397210 AAATTTGAGCAAAGATTTGAGGG + Intergenic
1073107038 10:101038201-101038223 ACATTTGAGGAACAGGTTGGTGG + Intronic
1073182635 10:101594357-101594379 ACATTTGAGCTGGATTTTGAAGG + Intronic
1074143569 10:110697733-110697755 AGACTTGAGCAAAAGCTTGAGGG - Intronic
1074456991 10:113603809-113603831 ATATTTGAGCAAGAGCCTTAAGG - Intronic
1074976552 10:118586533-118586555 ATATTTGAGCTAGACTTTGAAGG - Intergenic
1075139064 10:119815246-119815268 ACATCTGAGCAAGAGAGTCAGGG - Intronic
1075865042 10:125711261-125711283 AAATTTCAGCATGAGTTTGGTGG - Intergenic
1076503300 10:130953997-130954019 ACATCTGAGAAAGAACTTGAAGG + Intergenic
1077605460 11:3607780-3607802 ACATTTCAGCAAGAGACAGATGG + Intergenic
1077901281 11:6491131-6491153 ACATCTGAGCAAGGACTTGAAGG - Intronic
1078289591 11:9995213-9995235 ACATTTGAGTTAGGCTTTGAAGG + Intronic
1078356604 11:10636780-10636802 ACATTTGAGCTAGGTCTTGAAGG + Intronic
1078970151 11:16400343-16400365 ACATTTAAGCAAAAACTTGAAGG + Intronic
1079800842 11:24866767-24866789 ACATTTGTGCTAGACTTTGCAGG + Intronic
1079842652 11:25423794-25423816 AAATTTGAACACGAGTTTTAGGG + Intergenic
1080930086 11:36800789-36800811 ATACTTGAGCAAGGGTTTGATGG - Intergenic
1081690229 11:45073018-45073040 GCATTTGAGCTAGACTTTGAGGG - Intergenic
1081759562 11:45567809-45567831 ACATATGAGCAAGGCCTTGAAGG - Intergenic
1083177232 11:60958178-60958200 ACATTTCAGCATGAGATTGAGGG + Intergenic
1083332178 11:61904055-61904077 GCATTTGAGCCAGGTTTTGAAGG - Intronic
1083489432 11:63004527-63004549 ACATTTGAGCAAAGATCTGAAGG - Intronic
1083760516 11:64814194-64814216 ACGTTTGAGCAATATTGTGAAGG - Intergenic
1084951902 11:72671092-72671114 ACATTTGAGCCGGACCTTGAAGG - Intronic
1085543927 11:77299322-77299344 ACATTTGAGCAAGGAATTGAAGG - Intronic
1086320109 11:85637107-85637129 ACAATTGAGCTAAATTTTGAAGG + Intergenic
1087256055 11:95955356-95955378 ACATTTGAGCAAAGATTTAAAGG - Intergenic
1088051347 11:105518972-105518994 AAATTTGAGCAAAACTTGGAGGG + Intergenic
1088516120 11:110636120-110636142 CCCTTTGAGTAATAGTTTGAAGG - Intronic
1089410978 11:118242699-118242721 ATATTTGAGCTGGAATTTGAAGG - Intronic
1089754520 11:120676755-120676777 AAATTTCAACATGAGTTTGATGG + Intronic
1090223144 11:125048590-125048612 ATATTTGAGCAAAGATTTGAAGG - Intergenic
1090443934 11:126747513-126747535 ACATGTGAGCAGGCCTTTGATGG - Intronic
1090935425 11:131337461-131337483 ACATTTAAGCAAAACCTTGAAGG - Intergenic
1092077318 12:5684590-5684612 GTTTTTGAGCAAGACTTTGAAGG - Intronic
1092439408 12:8484957-8484979 ACATTTGAGCAATTGCTTCAAGG + Intergenic
1094068773 12:26389599-26389621 AGATTTCAGCAAAAATTTGAAGG - Intronic
1094277088 12:28689710-28689732 AAATTTGTGCAAGATTTTGGAGG - Intergenic
1095486240 12:42687609-42687631 ACATCTGAGCTAGAACTTGAAGG + Intergenic
1095576101 12:43741184-43741206 ACATTTAAGCAAAAGCTGGATGG - Intronic
1097340993 12:58437975-58437997 ACATTCGTGAAACAGTTTGAGGG + Intergenic
1098157763 12:67617946-67617968 ACATTTCAGTAAGTATTTGAAGG - Intergenic
1098561332 12:71876383-71876405 ACAACTGAGCAAGAGTTTCAAGG - Intronic
1098902654 12:76128870-76128892 AGATTTGAGCTAGATCTTGAAGG + Intergenic
1098988785 12:77042037-77042059 ACATTTGAGCCAGATCTTGAAGG + Intronic
1099207727 12:79747582-79747604 ACATTTGAGGATGATTTTTAAGG - Intergenic
1101282174 12:103269712-103269734 CCACTAGAGCATGAGTTTGAGGG - Intronic
1102277462 12:111593956-111593978 ACATTTGAGCAAAGATTTGAAGG - Intronic
1102507591 12:113393414-113393436 TCATCTGAGCAAGAGTTCCATGG + Intronic
1103217122 12:119210434-119210456 ATATTTGAGCAAATATTTGATGG - Intronic
1103916617 12:124379087-124379109 ACATTTGAGCCAAGATTTGACGG + Intronic
1104056577 12:125235302-125235324 ACATTTGAGATATAGTTTGGAGG - Intronic
1104157456 12:126147525-126147547 ACAGCTGAGCAAGATTTGGAAGG + Intergenic
1106578254 13:30996195-30996217 ACATTTCAACATGAGTTTGGAGG - Intergenic
1106578403 13:30997337-30997359 ATATTTGAACAAGACTTTCATGG + Intergenic
1107036347 13:35906493-35906515 GCATTTGTGCTAGATTTTGATGG + Intronic
1107038910 13:35928436-35928458 ACATTTGAGCAAAGACTTGAGGG - Intronic
1107206863 13:37801818-37801840 ACATTTGAGCTGGATTTTGAAGG + Intronic
1107687069 13:42912537-42912559 ACATTTGAGAAAGAATTCCATGG + Intronic
1108206296 13:48093931-48093953 ACATTTGAGCTGGATTCTGAAGG + Intronic
1108483504 13:50900692-50900714 ACATTTGAGCAAAGACTTGAAGG - Intergenic
1108552929 13:51564570-51564592 AAATATGAGAAAGAGTTGGAAGG - Intergenic
1108841181 13:54617308-54617330 AAATTAGAGCAAGACTTTAAGGG + Intergenic
1109188816 13:59301171-59301193 ACATTTGAGCAGAGATTTGAAGG + Intergenic
1110146221 13:72193577-72193599 ACATTTGAATAAGATTTTAAAGG + Intergenic
1110331189 13:74275058-74275080 ACATTTGAGCAAAGATCTGAAGG + Intergenic
1110560268 13:76904104-76904126 ACATTTGAGCAAAAGAGTGTTGG + Intergenic
1110618562 13:77569580-77569602 ATATTTGAGAAAGAGATTGCTGG - Intronic
1111411739 13:87886260-87886282 AGATTTGAGCAAATGTTTGAAGG - Intergenic
1111461382 13:88546910-88546932 ACAAATGATCAAGGGTTTGATGG - Intergenic
1111571120 13:90087627-90087649 AAATTTCAGCATGAGTTTGGTGG - Intergenic
1111885449 13:94014993-94015015 ACATTTGTGCAAAAGTTTTTTGG + Intronic
1112218168 13:97457860-97457882 TAATTTGAGCAAGAGTAGGAGGG + Intronic
1112314891 13:98351925-98351947 ACATTTCAACAAGATTTGGAAGG + Intronic
1112469332 13:99673513-99673535 ATATCTGAGCAAAAGTTTGAAGG + Intronic
1112844542 13:103623398-103623420 ACATGTGAGAAAGGGTTTTAAGG - Intergenic
1113807766 13:113119901-113119923 ACATTTGGGGGAGAGTTTGGGGG - Exonic
1114767201 14:25386977-25386999 ACATTTGAGCAAAGGCTTGAAGG + Intergenic
1114769015 14:25407948-25407970 ACATTTGAGCAATGATCTGAAGG + Intergenic
1115044086 14:28968551-28968573 ACATTTAAGCAAAACTTTGGAGG + Intergenic
1115839432 14:37451299-37451321 ACATTTGTGGAAGAGAATGAAGG + Intronic
1116054814 14:39850279-39850301 ACATTTTTTGAAGAGTTTGATGG - Intergenic
1116578093 14:46601731-46601753 ACATTTGAGCAAAAACTTGAAGG + Intergenic
1118178265 14:63464370-63464392 ACATTTGAGCAAATACTTGAAGG + Intronic
1118495337 14:66303407-66303429 ACATTTCAGCATGAGATTTAGGG - Intergenic
1119260753 14:73237009-73237031 ACATTTGACCAAGGTTTTGAGGG + Intergenic
1119770422 14:77217317-77217339 ACATCTGAGCAAGGACTTGAGGG - Intronic
1119811179 14:77520958-77520980 ACATCTGAGCAAAGATTTGAAGG - Intronic
1120322107 14:82976794-82976816 TCATTTAAGCAAAATTTTGAAGG - Intergenic
1121742610 14:96264675-96264697 ATATTGGAGCAAGACTTTTAGGG - Exonic
1121941805 14:98077915-98077937 ACATTTTAGTAAGAGTCTCAAGG - Intergenic
1124080728 15:26492408-26492430 ACATTTGAGCAAAGACTTGAGGG - Intergenic
1125958021 15:43804167-43804189 ACATTTCTCCAAGAGTTTCAAGG + Intergenic
1127607256 15:60599168-60599190 ATATTTGAGCTAGACCTTGAAGG + Intronic
1127607746 15:60606176-60606198 ACATTTTGGCCAGAATTTGAAGG - Intronic
1127798980 15:62461706-62461728 ACATTTCAGCGAGGGCTTGAAGG + Intronic
1127897658 15:63316561-63316583 ACATTTGAGCAGGATCTTGAAGG - Intergenic
1128206622 15:65858423-65858445 ACATTTGAGCAAAGATTTAAAGG - Intronic
1128402074 15:67293742-67293764 ACATGTGAGCACAAATTTGATGG + Intronic
1129532611 15:76280894-76280916 ACATCTGAACAAAGGTTTGAAGG - Intronic
1130015501 15:80183044-80183066 ACATTTGAGCCAGAGAAGGAAGG + Intronic
1130921521 15:88349569-88349591 ACATTTAAGAAAGAGTTCTATGG - Intergenic
1132813380 16:1813077-1813099 AGATTTGAGCATGCGTTTGGAGG - Intronic
1133915082 16:10102154-10102176 ACATTTCAACATGAGTTTGGAGG - Intronic
1134271531 16:12737247-12737269 ACATTTGAGCAACAACTTGAAGG + Intronic
1134511833 16:14854822-14854844 ACATTTGAGCAACAACCTGAAGG + Intronic
1134699476 16:16253321-16253343 ACATTTGAGCAACAACCTGAAGG + Intronic
1135142696 16:19935344-19935366 ACATTTGAGCAAAACTTTGAAGG + Intergenic
1136098598 16:27976805-27976827 ACATTTGAGCTGGATCTTGAAGG - Intronic
1136111505 16:28066406-28066428 ACATTGGAGCAAGGATTTGAAGG + Intergenic
1136657364 16:31718090-31718112 GCATTTGGGCAAGAGGATGAGGG - Intronic
1136673668 16:31879864-31879886 GCATTTGGGCAAGAGGATGAAGG - Intronic
1137303136 16:47173107-47173129 TCATTTGAACAAGGATTTGAAGG - Intronic
1137625505 16:49905469-49905491 ACATTTGAGCAAAGATTTGAAGG - Intergenic
1138435172 16:56994644-56994666 ACATTTGAGAGAGAACTTGAAGG + Intronic
1139837444 16:69850573-69850595 ACATTTGAGCAGTATTTTGAAGG + Intronic
1140025632 16:71288260-71288282 ACATTTGAGCAAATATTGGAAGG - Intronic
1140696171 16:77536395-77536417 ACATTTGGGGAAGAGCTGGAGGG - Intergenic
1140722833 16:77786960-77786982 ACATTTGGGCTAGACCTTGAAGG - Intergenic
1140850602 16:78931728-78931750 ACACTTGGGCAGAAGTTTGAAGG + Intronic
1141178146 16:81734256-81734278 ACATTTGAGCAAAAACCTGAGGG + Intergenic
1141251447 16:82362688-82362710 ACATTTGATCTAGGTTTTGAAGG + Intergenic
1142957866 17:3533381-3533403 ACATTTGAGCAAGGACTTGAAGG - Intronic
1144293679 17:13853031-13853053 ACATTTGAGCAGAAACTTGAAGG + Intergenic
1146468168 17:33103696-33103718 ACACCTGAGCAGAAGTTTGAGGG - Intronic
1146944799 17:36866279-36866301 ACATTTGAGCAAAGACTTGAAGG - Intergenic
1148224841 17:45892133-45892155 AAATTTGAGCTAGAGTTTGAAGG + Intergenic
1150568848 17:66368117-66368139 ACATCTGTGTAAGAGATTGAAGG + Intronic
1151663750 17:75533871-75533893 ACATTTGAGCAAAGCTTTGAAGG + Intronic
1152991311 18:366286-366308 ACATTTGAGCAAGAGTTTGAGGG + Intronic
1153060943 18:994561-994583 AATTTTGAGCAAGATTTTGAAGG + Intergenic
1154399932 18:14026670-14026692 GCATTTGAGGGAGAGTGTGATGG - Intergenic
1155581020 18:27306340-27306362 ACATGTGAGCATGAGTCGGAAGG - Intergenic
1157702270 18:49769314-49769336 ACATTTGAGCAAATGCTTGAAGG - Intergenic
1158051402 18:53225184-53225206 ACATTCGAGAGAGAGTATGAAGG + Intronic
1158114837 18:53983682-53983704 ACATTTTAGCAAAGATTTGAAGG - Intergenic
1158758742 18:60358370-60358392 ACATCTGAGCAAAAACTTGAAGG + Intergenic
1159269243 18:66127731-66127753 ACATTTGTACAAGATTTGGATGG + Intergenic
1159352611 18:67295308-67295330 ACATTGGAGCATGAGATTTATGG + Intergenic
1159908856 18:74124192-74124214 ACATAAGAGCAAGAACTTGAAGG + Intronic
1160014951 18:75133440-75133462 ACAATTGAGCAAGAGCTTTCTGG - Intergenic
1162308147 19:9888192-9888214 ACATTTCAGTAAGGGTCTGAAGG - Intronic
1162754006 19:12846459-12846481 ACATTGAAGCAAAAATTTGAAGG + Intronic
1162819391 19:13213324-13213346 ACATGTGAGCAAAGGCTTGAAGG - Intronic
1163011707 19:14430750-14430772 GCATTTGAGAAACAGTTAGAAGG + Intergenic
1163806323 19:19400481-19400503 ACACTAGATCAAGAGTTTGTGGG - Intronic
1163890262 19:20005463-20005485 AAATTTGAGCAACTGTTAGAGGG + Exonic
1164498917 19:28795619-28795641 ATATTTAACCAAGGGTTTGAAGG - Intergenic
1165335783 19:35168749-35168771 ACATTTGAACAAAGGTCTGAAGG - Intronic
1165463935 19:35960848-35960870 ACATTTGAGCAAAGGCTTGAAGG - Intergenic
1165731034 19:38144871-38144893 ACATCTGAACAGAAGTTTGAGGG + Intronic
1165946563 19:39446490-39446512 ACATTTGAGCAAAAACTTGTTGG + Intronic
1166616085 19:44248030-44248052 ACAATTGGACAAAAGTTTGAAGG - Intronic
1167128410 19:47567832-47567854 ACATTTAAGCCTGAGTTTGGAGG - Intergenic
1167161725 19:47772164-47772186 ACATTTGAGCAAAGATATGAAGG + Intergenic
1167276074 19:48540434-48540456 ACATTGGAACAAGCCTTTGAAGG - Intergenic
1167654798 19:50756542-50756564 ACATTTGAGCAAAGTTTTGGAGG - Intergenic
1167656478 19:50767623-50767645 ACATTTGAGCAAAGATTTGGAGG - Intergenic
1167695359 19:51012467-51012489 ACATTTGTGCAGGAGTTTAAAGG - Intergenic
1167843988 19:52145424-52145446 ACATTTGAGAAGTGGTTTGAGGG - Intergenic
925538592 2:4942025-4942047 ATATTTGAGAAAGATCTTGAGGG + Intergenic
925541688 2:4974306-4974328 ACATTCGTGCCAGAGCTTGAAGG + Intergenic
925594956 2:5545896-5545918 ATATTTGAGCAGGACCTTGAGGG + Intergenic
925800330 2:7592515-7592537 ACAAATGAGAAAGACTTTGAAGG + Intergenic
926066851 2:9847691-9847713 ATATTTTTGCAAGAGTTTCACGG + Intronic
926669510 2:15562949-15562971 ACATTTGAGCAAAAACTTGAAGG - Intergenic
927136606 2:20101286-20101308 ACTTTTGAGCAAAGGTCTGAAGG - Intergenic
927361670 2:22242503-22242525 GCATATGAGCAAGAGCATGAGGG - Intergenic
927734602 2:25507984-25508006 ACATTTGAACATCAGCTTGAAGG - Intronic
928373636 2:30758621-30758643 AGATTTGAGCAAGACTGAGATGG + Intronic
928386522 2:30873050-30873072 ACATTTGAGCAAACATTTGAAGG - Intergenic
928560031 2:32472471-32472493 ACATTGGTGGAAGAGTTTTAGGG + Intronic
928895470 2:36257457-36257479 ACGTTTGGGCAAGGGTTTCAAGG - Intergenic
928908461 2:36393683-36393705 ACATCTGAGCTAGGTTTTGAAGG + Intronic
928959676 2:36911141-36911163 ACATGTGAGCCAGATTTGGAGGG - Intronic
929719400 2:44352087-44352109 ACATTTGAGCAATAGCTTTAAGG - Intronic
930580810 2:53209675-53209697 ACATTTGAGCCAGGTTTAGAAGG + Intergenic
930689131 2:54341182-54341204 ACATTTCAACATGAGTTTGGAGG - Intronic
930741265 2:54835107-54835129 TTATTTGAGCAAAGGTTTGAAGG - Intronic
930781604 2:55229441-55229463 ACATTTGAGGAACAGCTAGAGGG + Intronic
930814609 2:55581380-55581402 ACATTTTACTAAGATTTTGACGG + Intronic
930919215 2:56731284-56731306 ACATTTAAAAAAGACTTTGAGGG + Intergenic
931198962 2:60078665-60078687 ACATTTGAGCCAGGTATTGAAGG + Intergenic
931723949 2:65090685-65090707 ACATATAGGCAAGAGTTTGTAGG - Intronic
932836036 2:75038323-75038345 ACATTTGATCTAGGATTTGAAGG + Intergenic
933388819 2:81645366-81645388 ACACATGAGCCAGAGTTTGGAGG + Intergenic
934035774 2:88087549-88087571 ACATTTGAGCTGGAATTGGAAGG - Intronic
934726405 2:96622882-96622904 ACATTTGAGCAACAACCTGAAGG - Intronic
935131570 2:100264862-100264884 ACCCTTGAGCATGGGTTTGAGGG + Intergenic
935402788 2:102678038-102678060 ACATTTGAGCAACACCTTCATGG - Intronic
935616060 2:105083169-105083191 ACAATTGAGCAAAGGTGTGAAGG + Intronic
935803014 2:106717439-106717461 ACAGTTCAGCCAGAGTCTGAAGG + Intergenic
936494533 2:113006525-113006547 ACCTCTGAGCCAGAGTTTTAAGG - Intronic
936538498 2:113330843-113330865 ACATTGGAGAGGGAGTTTGAGGG - Intergenic
936926172 2:117739213-117739235 TCATTTCAGCAGAAGTTTGAAGG - Intergenic
939046713 2:137258518-137258540 ATATTTGAGTAAGAACTTGAAGG - Intronic
939248256 2:139652933-139652955 ACATTTTAGTAATAGTATGATGG + Intergenic
939287141 2:140146613-140146635 ACATTTGAGCAAAAGGGTGTGGG - Intergenic
939333686 2:140797932-140797954 ACAGTTGAGCAAAAATCTGAAGG - Intronic
940942965 2:159583835-159583857 ACATCTGAGCAATGGTTTGAAGG + Intronic
940979775 2:159988559-159988581 ACATTTGAGCTGAATTTTGAAGG + Intronic
941707088 2:168670657-168670679 ACCTTTGAGCAAAAGCCTGAAGG - Intronic
941900685 2:170675424-170675446 ACATTTGAGCTAAGATTTGAAGG + Intergenic
942850116 2:180474256-180474278 AGATTTGGGCAATAGTTTCAAGG - Intergenic
942970165 2:181949105-181949127 ATATTTGAGAAAGATTCTGATGG - Intergenic
943614742 2:190080466-190080488 ACATTTGAGCTGGATCTTGAAGG + Intronic
943642681 2:190376330-190376352 ACATTTGAGCAAAGTTTTGATGG - Intergenic
943717950 2:191172982-191173004 ATTTTTGAGCCAGATTTTGAAGG + Intergenic
943878398 2:193103980-193104002 ACGTTTAAGCAAGAGTTAAAAGG - Intergenic
944509503 2:200450889-200450911 ACCTTTGAGCAGGATCTTGAAGG + Intronic
944632177 2:201638576-201638598 ACATTACAGCATGAGTCTGAAGG - Intronic
944884489 2:204048815-204048837 ACATCTGAGCAGAACTTTGAAGG + Intergenic
945140749 2:206683851-206683873 ACATTTGATCAAAGTTTTGAAGG - Intronic
945607204 2:211949747-211949769 ATATTTGAGCAAAAACTTGAAGG - Intronic
945969472 2:216221763-216221785 ACATATTAGCAAGAGTAGGAGGG - Intergenic
946138681 2:217669311-217669333 CCATTTGAGCAAGGATTTCAAGG + Intronic
946471576 2:219965614-219965636 ACGTTTGAGGAAGAGTTTCAAGG + Intergenic
946815582 2:223575175-223575197 ACACATGAGCTAGACTTTGAAGG + Intergenic
946872035 2:224092893-224092915 AGATTGGAGAAAGAGGTTGAGGG + Intergenic
947088775 2:226486291-226486313 ATATTTAAGCCAGAATTTGAGGG - Intergenic
1168857687 20:1020209-1020231 ACATTTGAGCAGAAGCCTGAAGG + Intergenic
1168903498 20:1385867-1385889 ACATTTGAGCAAAGACTTGAAGG - Intronic
1169136759 20:3202481-3202503 TCATTTCAGCCAGGGTTTGATGG - Intronic
1169411171 20:5371661-5371683 ACATTTGAGCAAAGATTTGAGGG - Intergenic
1170242199 20:14179718-14179740 ATATTTGTGCCAGAATTTGAAGG + Intronic
1171133943 20:22679634-22679656 ACATTTGAGGGAGACTTTGAAGG - Intergenic
1171253329 20:23667344-23667366 ACATGTGAGCTAGACTTTTAAGG + Intergenic
1171259800 20:23722598-23722620 ACATTTGAGCTAGACTTTTAAGG + Intergenic
1171268878 20:23798129-23798151 ACATGTGAGCTAGACTTTTAAGG + Intergenic
1172081563 20:32345152-32345174 ACATTAGAGCTAGACTGTGAAGG + Intergenic
1172240880 20:33411876-33411898 ACATTTGAGCTGGACTTTGATGG - Intronic
1172630925 20:36377725-36377747 CCACTTGAGCAAGAGTTGGCAGG + Intronic
1172833287 20:37855262-37855284 ACATCTGAGCTGGATTTTGAAGG - Intronic
1173077895 20:39837900-39837922 ACATTTAAGCAGCAATTTGAAGG + Intergenic
1173164582 20:40678021-40678043 AGATTTCAGCAAGAACTTGAAGG + Intergenic
1173175026 20:40758059-40758081 ACATTTGAGCAAAGATTCGAAGG - Intergenic
1173323691 20:42012972-42012994 ACAGTTGAGCTAGACTTTCATGG - Intergenic
1173539943 20:43843736-43843758 ACCCTTGAGCAAGATTTTAAAGG + Intergenic
1173559396 20:43992082-43992104 ACATTTGAGCAACGACTTGAAGG + Intronic
1173613337 20:44386992-44387014 ACATTTTAGTAAGTGTTTAATGG - Intronic
1173853914 20:46237550-46237572 TCATTTGAGCAACTATTTGAAGG - Intronic
1174478019 20:50811004-50811026 ATATTTGAGCAAAAGCTAGAAGG + Intronic
1176876936 21:14139754-14139776 GCATTTGAGCAAAAGCTTGGAGG + Intronic
1178222500 21:30675773-30675795 ACATTTTTGCAAGTGTTTGGGGG + Intergenic
1178826688 21:36023439-36023461 CCATGTGAGCTGGAGTTTGAAGG + Intergenic
1179021052 21:37641549-37641571 ACATTTGAGCTAAGATTTGAAGG + Intronic
1179174701 21:39000020-39000042 ACATCTGAGGAAGATATTGATGG + Intergenic
1179496596 21:41775738-41775760 ACATTTGGGCAAGGGTCTTATGG + Intergenic
1179535224 21:42047054-42047076 AAATTTCAGCATGAGTTTGGAGG + Intergenic
1181406569 22:22689171-22689193 CCATTTGAGAAAGACTGTGAAGG - Intergenic
1181458344 22:23071777-23071799 ACATTTGAACTGGAGCTTGAAGG + Intronic
1181897894 22:26126885-26126907 ACATTTGAGCTAAGTTTTGAAGG + Intergenic
1182418144 22:30234634-30234656 ACATTTGAACAGGACCTTGAAGG + Intergenic
1183016014 22:34987770-34987792 ACATTTGAGCAAAATTTTGAAGG - Intergenic
1183135049 22:35879118-35879140 ACATTTGAGCAAAAATTTGAAGG + Intronic
1183710696 22:39501787-39501809 GCATTTGAGGTAGACTTTGAAGG + Intronic
1183762745 22:39839410-39839432 AAATTTGAACAAGGCTTTGAAGG + Intronic
1184574450 22:45351039-45351061 ACATTTGAGCAAAGATTTGAAGG - Intronic
1184922115 22:47613115-47613137 AGCTTTGAGCAAGAGGTTGTAGG - Intergenic
1185139657 22:49093252-49093274 ACATTTGTACAGGACTTTGAGGG - Intergenic
949815867 3:8057168-8057190 AGATTTGAGCAAGGGCTTCATGG + Intergenic
949879481 3:8650112-8650134 ACATTTGAGCAAAGGCCTGAAGG - Intronic
950196407 3:11012129-11012151 TCCTTTGAGCAAGGCTTTGAAGG - Intronic
950284733 3:11735758-11735780 ACATTTGAGCAGGAACGTGAAGG + Intergenic
950434856 3:12973357-12973379 ACATTTGAGCTGGGCTTTGAAGG - Intronic
950448088 3:13049604-13049626 ACATTTGAGCAGGGTTTTGAAGG - Intronic
950717203 3:14857473-14857495 ACATTTGAGAGATAGTTTGGAGG - Intronic
952158674 3:30671407-30671429 ACATTTAAGCTGAAGTTTGAAGG + Intronic
952897369 3:38086616-38086638 ACATTTGAGCCAGGGCTTGAAGG - Intronic
953115848 3:39991669-39991691 ACATTTGAGCAAATACTTGAAGG - Intronic
954087975 3:48261293-48261315 ACATTTGAGCAAAGGCTTGAAGG + Intronic
955088809 3:55729352-55729374 ACATTGGAGCAAGGACTTGAAGG - Intronic
955202970 3:56867949-56867971 AGATGTGATCAAGAGTGTGATGG - Intronic
955550858 3:60083643-60083665 ACATTAGAGAAAAGGTTTGAGGG - Intronic
956266893 3:67406488-67406510 ACATTTAAGCTAGAGTCTGAAGG + Intronic
957185035 3:76930360-76930382 ACATTTGAGGAAAGGTCTGAGGG - Intronic
957799235 3:85053397-85053419 ACAAGTGACCAAGAATTTGAAGG + Intronic
957895296 3:86413488-86413510 AGATCTCAGAAAGAGTTTGAGGG + Intergenic
958709832 3:97704447-97704469 ACAATTCAGTCAGAGTTTGAAGG - Intronic
958979774 3:100707844-100707866 ACCTTTGAGCAATTGTTTGCAGG - Intergenic
959412966 3:106047875-106047897 ACATTTGAGCAATAATAAGAAGG + Intergenic
960307961 3:116085636-116085658 CCAATTGAGCAACAGTTTGGGGG + Intronic
960524559 3:118695005-118695027 ACATTTGAGCTAGGCTTTGCAGG + Intergenic
960623340 3:119657076-119657098 ACATTTGAGCTGAATTTTGAGGG + Intronic
961907870 3:130281399-130281421 ACACTTGAGCAAAGATTTGAAGG + Intergenic
962076770 3:132090406-132090428 ATATTTGAGCAAAGGCTTGAAGG - Intronic
962314340 3:134349831-134349853 ACATTTGAGCAAAGATTTGAAGG - Intergenic
962357094 3:134704193-134704215 ACATTTGAGTTGGAATTTGAAGG - Intronic
963631996 3:147745039-147745061 ACATTTGAGCAAATACTTGAGGG + Intergenic
963900660 3:150730104-150730126 ATATTTGAGCAAATGCTTGACGG - Intergenic
964024216 3:152052247-152052269 ATATTTGAGCTAGATCTTGAGGG + Intergenic
965117496 3:164511192-164511214 ACATTTCAACATGAGTTTGGTGG - Intergenic
965788666 3:172363975-172363997 ACATTTGAGCTTGACTTTGGAGG + Intronic
965797724 3:172458581-172458603 GCATTGGAGCTAGAGTTTGGAGG + Intergenic
966056447 3:175697029-175697051 AAATTTCAGCATGAGTTTGGAGG + Intronic
967195642 3:187023176-187023198 ACATTTGAGCAAGGGTTGGAAGG - Intronic
968040897 3:195588460-195588482 TCATTTGGGAAATAGTTTGATGG + Intergenic
969602809 4:8187049-8187071 ACATTTGAGCAGGGCTTTGAAGG - Intronic
969940185 4:10724292-10724314 ACATGTGAGCAACAACTTGAAGG - Intergenic
970123381 4:12782495-12782517 ACATTTGAATAGGAGTTTGTTGG + Intergenic
970295293 4:14623266-14623288 ACAAATGAGCAAGAGTATGTTGG + Intergenic
972357315 4:38292149-38292171 ACATTTGATCAAAAATCTGAAGG - Intergenic
972547641 4:40095739-40095761 ACACTTGAACAAAAATTTGAAGG + Intronic
975119922 4:70717107-70717129 CCAGTTGAGCAAGGGTTTCAGGG + Intronic
975688294 4:76939747-76939769 AAATCTAAGCAAAAGTTTGATGG + Intergenic
975859327 4:78659522-78659544 CCATTTGAGCAAGAGTTGAGAGG + Intergenic
976951967 4:90844581-90844603 ACATTTGAGCAAATTTTTGAAGG - Intronic
977048299 4:92094336-92094358 ACATTTGAACAAAGATTTGAAGG - Intergenic
977337253 4:95715039-95715061 ACATTTGAGGAAGAGTTATGTGG - Intergenic
977828691 4:101564321-101564343 ACATTTGAACAAGAACATGAAGG - Intronic
977850193 4:101818015-101818037 ACATTTGTGCCAGAGTGTGAAGG - Intronic
978428758 4:108610092-108610114 ATATGAGAGGAAGAGTTTGAAGG + Intergenic
979060197 4:116048146-116048168 AGATTTAAGTAAGGGTTTGATGG + Intergenic
979319963 4:119311665-119311687 ACATTTGAGCAACACTTGAAGGG - Intergenic
979629911 4:122888688-122888710 ACATTTGAGCAAATGCTTGAAGG - Intronic
981678400 4:147365877-147365899 ACATTTGAGCAAAGACTTGAAGG + Intergenic
982514011 4:156321207-156321229 ATATTTAAGCAAATGTTTGAAGG + Intergenic
983064729 4:163195189-163195211 AGATTAGAGCAGGAGTTTAATGG + Intergenic
983669651 4:170221465-170221487 AAATTTCAACATGAGTTTGAAGG - Intergenic
984048711 4:174836625-174836647 ACATTTTAGCGAGATTTTGCTGG - Intronic
984499131 4:180536275-180536297 AAATTAGAGAAAGACTTTGAAGG - Intergenic
984602364 4:181743481-181743503 ATATTTGAGCAAAGGCTTGAAGG + Intergenic
985053874 4:186019172-186019194 ACATTTTAGCAAAGATTTGAAGG + Intergenic
986665333 5:10097800-10097822 TCAGTTGCTCAAGAGTTTGAGGG - Intergenic
986875046 5:12097143-12097165 ACATTTGAGCAGGACCTTGGAGG + Intergenic
987777723 5:22390892-22390914 ACATCTGAGCAAGGATTTTAAGG - Intronic
987872557 5:23639738-23639760 ACATCTGAGCTGGATTTTGAAGG - Intergenic
988396505 5:30702598-30702620 ACATTTAAGCAAAAACTTGAAGG + Intergenic
989100546 5:37818824-37818846 ACATTTGAGCAAAGACTTGAAGG - Intronic
989427581 5:41314588-41314610 ACATTTGTGCAAAGGTTTGAAGG + Intronic
990171488 5:53054962-53054984 TCATTTGAGTAAAAGTTTAAGGG + Intronic
990851308 5:60208290-60208312 ACATTTGAGTAACAGCTTAATGG + Intronic
991272677 5:64803579-64803601 ACATTTGAGCAAAGATCTGAAGG + Intronic
992743888 5:79800476-79800498 ATATTTTAGAAAGATTTTGAGGG - Intergenic
992904092 5:81328176-81328198 ACATTTGAGCAAAAGCCTGCAGG - Intergenic
993552031 5:89285082-89285104 ACTTTTGAGCAAAAAATTGAAGG - Intergenic
993998153 5:94746996-94747018 ATACTTGAGCTAGACTTTGAAGG - Intronic
994682750 5:102909600-102909622 AGATTTGACCAAGATGTTGATGG + Intronic
995641994 5:114267435-114267457 ACTTTTGAGTATCAGTTTGAGGG + Intergenic
996931821 5:128897845-128897867 ATATTTGAGCTAGATGTTGAAGG + Intronic
996960356 5:129240238-129240260 ACATCTGAGATAGAGTTTCAGGG - Intergenic
997093138 5:130879675-130879697 ACATTTGAGCAAAAGCCTGAAGG + Intergenic
997481703 5:134190201-134190223 TTATTTGAGCCAGAGTTTGAAGG - Intronic
997591936 5:135079386-135079408 ACTTTTCAGAAAGAGGTTGAAGG - Intronic
997899022 5:137746560-137746582 ACATTTGAGCAAAGACTTGAAGG - Intergenic
998240113 5:140433469-140433491 ACATTTGAACTAGGCTTTGAAGG - Intronic
998373791 5:141678453-141678475 ACATTTGATCAAAAACTTGAAGG - Intronic
999309149 5:150540363-150540385 ACATTCGAGCGAGAGTGTGAAGG - Intronic
1000059667 5:157642692-157642714 ACATTTGGACAAGCTTTTGAAGG - Intronic
1000096435 5:157974747-157974769 ATATTTGAGCTGGGGTTTGAAGG + Intergenic
1000262219 5:159598841-159598863 ACAGTTGAGCAAAGATTTGAAGG - Intergenic
1001615003 5:173036138-173036160 ACATTTCAACAATAGTATGATGG - Intergenic
1001759555 5:174195871-174195893 TCATTTGAGCAAGTGTTAAAAGG + Intronic
1002783431 6:383898-383920 ACATTTGAGCAGAACTTTGATGG - Intergenic
1003935333 6:10970165-10970187 ACATTTGAGCTGAAGTCTGAAGG + Intronic
1004830121 6:19467597-19467619 GCATTTGAGCTAGAGTTTGAAGG - Intergenic
1005366766 6:25086396-25086418 ACCTCTGAGCAAGAATTTGGTGG - Intergenic
1005671929 6:28115036-28115058 ACATTTGAGGAGGAAATTGAGGG - Intergenic
1005910582 6:30306162-30306184 GCATTTGAGCCAGAGGTAGAAGG - Intergenic
1006835474 6:36996348-36996370 ACATTTAAGCAAAGATTTGAAGG + Intergenic
1007153334 6:39717451-39717473 ACATTTGAGCAAAGACTTGATGG - Intronic
1007772757 6:44204317-44204339 ATATTTGAGCAAAGATTTGAAGG + Intergenic
1007882554 6:45183671-45183693 ACATTTCAGCGAGATTTGGAGGG + Intronic
1008074504 6:47131665-47131687 ACATTTGACCAAAGGGTTGAAGG - Intergenic
1008164951 6:48125119-48125141 AAACTTGAACTAGAGTTTGAAGG + Intergenic
1008287354 6:49670150-49670172 ACATTTGAAGAAAAGTCTGAAGG - Intergenic
1008501113 6:52184330-52184352 ACATTTAAACAGGATTTTGAAGG + Intergenic
1008600624 6:53090604-53090626 ACATTTTAACATAAGTTTGAGGG + Intronic
1009566226 6:65314173-65314195 ACATTTGAGAAAGTACTTGAAGG - Intronic
1009812463 6:68686137-68686159 GCAATTTTGCAAGAGTTTGATGG - Intronic
1010055662 6:71560826-71560848 ACATTTCAGCTAGAGTCTAAAGG - Intergenic
1012382801 6:98640398-98640420 ACATTTCAGCAAGAGGATGCTGG + Intergenic
1012416214 6:99016825-99016847 ACATTTGAGCAAAGACTTGAAGG - Intergenic
1012576664 6:100810289-100810311 TTATTTGAGCTAGATTTTGAAGG - Intronic
1012782345 6:103578744-103578766 ATATTTGAGCTGGAATTTGAAGG + Intergenic
1013492665 6:110664278-110664300 GCATTTGAGCTGGACTTTGAAGG - Intronic
1014002913 6:116385009-116385031 ACATTTGAGCAAAAATTTAAAGG + Intronic
1014504514 6:122238259-122238281 TTATTTGGGCAACAGTTTGAAGG - Intergenic
1015479862 6:133696830-133696852 AAATTTCAGCAAAAGTTTGAGGG - Intergenic
1015713546 6:136167100-136167122 AGATTTGAGCAAAAGCTTGAAGG - Intronic
1015810762 6:137159810-137159832 ACATTTGAGCAAAGACTTGAAGG - Intronic
1015945968 6:138501494-138501516 AGATTTGAGCAAAACCTTGAAGG + Intronic
1016385984 6:143531449-143531471 AAATTTCAACAAGAGTTTGGAGG - Intergenic
1016618670 6:146081934-146081956 ACATTTTAGCCAGATTTTGAAGG + Intronic
1016869469 6:148802441-148802463 TCAATGGAGCAAGACTTTGATGG + Intronic
1016905743 6:149149217-149149239 ACATTTGAGTAAAAATGTGAAGG + Intergenic
1016999989 6:149989998-149990020 AGATTGGAGCAGGAGTTTTATGG - Intergenic
1017329776 6:153182914-153182936 ACATTTGAGCATTTATTTGAAGG + Intergenic
1017339813 6:153307609-153307631 ACATTTTAAATAGAGTTTGATGG + Intergenic
1018774608 6:167001148-167001170 ACAGGTGAGCAATAGATTGAGGG - Intronic
1019949916 7:4363046-4363068 ACATTTGGGCAAAAAATTGAAGG - Intergenic
1020404543 7:7817184-7817206 ATATTTGAGCAGGGGTTTGAAGG - Intronic
1020675295 7:11176795-11176817 AAATTTGTGCAAATGTTTGAAGG + Intergenic
1021048028 7:15946807-15946829 ACATTTGGGTCATAGTTTGAAGG - Intergenic
1021593970 7:22294798-22294820 ACATTTTAGCAAGACTATGCTGG - Intronic
1022698524 7:32734312-32734334 ACATTTGAACTGTAGTTTGAAGG + Intergenic
1024003799 7:45210657-45210679 ACATTTGAGAAAAATTTAGATGG - Intergenic
1024706581 7:51967641-51967663 ACATTTGAATGAGAGCTTGAAGG - Intergenic
1024952670 7:54880729-54880751 ACATTTTAGCAAAATTTTAAGGG + Intergenic
1025793042 7:64710249-64710271 ACATTTGAGCAACTGCTTCATGG - Exonic
1025972707 7:66342898-66342920 ACATTTCAGCATGAGTTGGAGGG + Intronic
1026504182 7:70968262-70968284 ACATTTGAGCTGGACTTTGGAGG + Intergenic
1027375776 7:77547750-77547772 ACATTTGAGCTGGTTTTTGAAGG + Intronic
1027769300 7:82386353-82386375 ACATTTGCACATGAGATTGAGGG + Intronic
1028026535 7:85849080-85849102 ACATTTAAGCAGGACTGTGAGGG - Intergenic
1028371346 7:90096081-90096103 AGAATTGAGCAAGACTTTCAAGG - Intergenic
1028688262 7:93618603-93618625 AAATTTGAGGAAGCTTTTGAGGG - Intronic
1029074499 7:97925349-97925371 ACATTTGTGGAAATGTTTGAGGG - Intergenic
1030944785 7:115704513-115704535 ACATTTGAGCAAGCATCAGAAGG - Intergenic
1031219628 7:118948730-118948752 ACTTATGACCATGAGTTTGAAGG + Intergenic
1031808771 7:126339954-126339976 AAAGTTGAGCGTGAGTTTGAAGG + Intergenic
1032787792 7:135214284-135214306 ACATTTGAGCAAATGCGTGAAGG - Intergenic
1033260905 7:139843193-139843215 ACATTTAGACAAGATTTTGAAGG - Intronic
1035659422 8:1335634-1335656 ACGTATGAGTAGGAGTTTGATGG + Intergenic
1035908279 8:3537301-3537323 TCATATAAGCAAGAGTTTGCGGG - Intronic
1036731164 8:11266345-11266367 TCATTTGAGCGAGAGTTGGGAGG - Intergenic
1037586341 8:20279111-20279133 ACATTTGAGCTGGACCTTGAAGG - Intronic
1038123429 8:24643743-24643765 TTGTTTGAGCAAGAATTTGAAGG - Intergenic
1040605819 8:48930172-48930194 ACAATTGAGTAAGATTTTGTTGG + Intergenic
1040889893 8:52306162-52306184 ACATTTGAGTAAAGATTTGAAGG - Intronic
1041167826 8:55108102-55108124 ATATCTGAGCAAAGGTTTGAGGG + Intronic
1041228648 8:55727128-55727150 ACAGTTGAGCAAGATGTGGAAGG - Intronic
1042333193 8:67604391-67604413 GCATTTGAGCAAAGGTCTGAAGG - Intronic
1042364880 8:67924581-67924603 ACATTTAAAAAAGATTTTGAAGG + Intergenic
1043106034 8:76111199-76111221 AAATTTCAACATGAGTTTGATGG + Intergenic
1043962634 8:86434466-86434488 ACATTTGAGCAAAAACATGAAGG - Intronic
1043991680 8:86763376-86763398 ATATTTGAACAATACTTTGAAGG + Intergenic
1044506703 8:93028783-93028805 AAATTTGAGCAAAGATTTGAGGG - Intergenic
1046045834 8:108963262-108963284 TCATTTGGGCAGGAGTTTGTAGG - Intergenic
1046173858 8:110548854-110548876 AAATTTGTGCAAGATTTAGAAGG - Intergenic
1046237632 8:111447369-111447391 ATATTTCAACAAGAGTTTGGAGG + Intergenic
1046306193 8:112370624-112370646 ACATTTGAGCAAGTAGTGGAAGG - Intronic
1046341082 8:112855224-112855246 TTATGTGAGCAAGAGTTTGAAGG - Intronic
1046810005 8:118523240-118523262 TCATTTCCGCAAGAGGTTGAGGG - Intronic
1047189745 8:122667279-122667301 ACATTTGAGCAGGTGTCTGCTGG - Intergenic
1047193258 8:122698034-122698056 ACATTTGAGCATGAGCTCAAAGG - Intergenic
1047692877 8:127374264-127374286 ACTCAGGAGCAAGAGTTTGAGGG + Intergenic
1048199770 8:132362659-132362681 ACATTTGAGCCAGGCTATGAAGG + Intronic
1048435505 8:134413194-134413216 ACACTGGAGCAAGAGATTGCTGG + Intergenic
1050326512 9:4502983-4503005 ACATTTGAGCAAAAGGATTAGGG - Intronic
1050731535 9:8714688-8714710 ACATTTAAGCAAAGATTTGAAGG - Intronic
1050825783 9:9943675-9943697 ACATCTGAATAAGAATTTGAAGG + Intronic
1050998700 9:12253054-12253076 ACATTTGAGTAAAAATCTGAAGG + Intergenic
1051255939 9:15213567-15213589 TCATCTAAGCAAGTGTTTGAGGG + Intronic
1051479978 9:17549385-17549407 ACATTTGAACATGAGTTAGCTGG + Intergenic
1051839174 9:21375028-21375050 ACAAGTGAGCAAAACTTTGAAGG - Intergenic
1052216619 9:25973503-25973525 ACATTTTAGCAAGATCTTAAAGG + Intergenic
1052953587 9:34233788-34233810 ACATTTGAGCAAAAACTTGAAGG + Intronic
1053236813 9:36462617-36462639 ACATTTGAGCAGAAATTCGAAGG - Intronic
1053341717 9:37341732-37341754 ACATTTGAGCCAAGGCTTGAAGG + Intronic
1053816465 9:41917468-41917490 ACATTTAACCAAGAGGTAGAGGG - Intronic
1054106725 9:61061150-61061172 ACATTTAACCAAGAGGTAGAGGG - Intergenic
1054614132 9:67269975-67269997 ACATTTAACCAAGAGGTAGAGGG + Intergenic
1055705114 9:78990834-78990856 ACATTTGCTCAAGGGTTTAAGGG + Intergenic
1055973347 9:81932648-81932670 ACATTTGAGCAAGAAATTTGAGG + Intergenic
1055975101 9:81947740-81947762 ACATTTGAGCAAGAAATTTGAGG + Intergenic
1057080818 9:92173211-92173233 AGGTTTGAGGAGGAGTTTGAGGG + Intergenic
1057106291 9:92420863-92420885 GCATTTGACCTAGACTTTGAAGG + Intronic
1058216528 9:102240809-102240831 AGATGTGTGCAAGACTTTGAAGG - Intergenic
1058743158 9:107964654-107964676 ACCTTAGATCAAGAGTTGGAAGG - Intergenic
1058934461 9:109755360-109755382 ACATTACAGAAAGAGTCTGAAGG - Intronic
1059382904 9:113942142-113942164 GCTTTTGAGCAGGACTTTGAAGG + Intronic
1059658680 9:116379819-116379841 ACATTTGAGCTAGATCTTGAAGG + Intronic
1059847286 9:118294323-118294345 ACATTTGGGCAAAATCTTGAAGG - Intergenic
1060958571 9:127662846-127662868 ACATCTGAGCAAGGGCTTGAAGG - Intronic
1203560729 Un_KI270744v1:54423-54445 ACATTTGAGGAATTGTTTTAGGG + Intergenic
1186747140 X:12581835-12581857 GCATTTGAGCAAGAATCTGAAGG - Intronic
1187314188 X:18176902-18176924 ACATTTGAGCTGGATTCTGAAGG - Intronic
1189074007 X:37897026-37897048 ACATTTGAACAAACATTTGAAGG + Intronic
1189136526 X:38556260-38556282 ACGTTTCAGCATGATTTTGATGG + Intronic
1189212570 X:39296330-39296352 ACATTTCAACATGAGTTTGGAGG + Intergenic
1190937625 X:55010629-55010651 AAACTTGAGCAAAAATTTGAAGG - Intronic
1191587437 X:62844184-62844206 CCATTTTAGTAAGGGTTTGAAGG + Intergenic
1192316021 X:70052523-70052545 GCATTTGAGCAAAGGCTTGAAGG + Intergenic
1192334097 X:70203085-70203107 ACATTTGAGCAAAGACTTGAAGG - Intronic
1192346610 X:70314122-70314144 ACATTTGAGGTAGATTTCGAGGG + Intronic
1192370526 X:70509028-70509050 ACATTTGAGCTGGAGCTTGAAGG - Intergenic
1193224385 X:78964881-78964903 ACATTTCAGCCTGAGTTTTAAGG + Intergenic
1194298494 X:92156379-92156401 ACATTTAAGCAAAGATTTGAAGG - Intronic
1195370145 X:104165860-104165882 ACGTTTGAGCTGGAGTTTGAAGG + Intergenic
1195916285 X:109939444-109939466 ACAGTGGAGCAAGTATTTGAGGG + Intergenic
1196596214 X:117548590-117548612 TCATTTGAGCATGCTTTTGAAGG - Intergenic
1196781155 X:119385621-119385643 ACATTTGAGCAAATCTCTGAAGG + Intergenic
1196921135 X:120586418-120586440 ACATTTGAGCAAAGACTTGAAGG + Intergenic
1197308247 X:124870533-124870555 ACATTTAAGCAAAAGCTTGATGG + Intronic
1197409839 X:126102992-126103014 AAATTTCAGCATGAGTTTGGAGG + Intergenic
1199474409 X:148230018-148230040 ATATTTGAGAAAGACCTTGAAGG + Intergenic
1199576841 X:149320518-149320540 ACATTTGAGCAATACTTTTAAGG + Intergenic
1200616104 Y:5381340-5381362 ACATTTAAGCAAAGATTTGAAGG - Intronic
1201227777 Y:11834876-11834898 GCATTTGAGCATGGCTTTGAGGG - Intergenic
1201426614 Y:13858388-13858410 ACATTCAAGCAAAAGCTTGATGG + Intergenic