ID: 1152995324

View in Genome Browser
Species Human (GRCh38)
Location 18:401201-401223
Sequence TTGGTACTATCTGCATTCGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 102}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152995321_1152995324 -8 Left 1152995321 18:401186-401208 CCTCCTATGTTCTTTTTGGTACT 0: 1
1: 0
2: 0
3: 14
4: 252
Right 1152995324 18:401201-401223 TTGGTACTATCTGCATTCGGAGG 0: 1
1: 0
2: 0
3: 2
4: 102
1152995317_1152995324 14 Left 1152995317 18:401164-401186 CCCAGCTATTCTCACCAATACGC 0: 1
1: 0
2: 0
3: 3
4: 28
Right 1152995324 18:401201-401223 TTGGTACTATCTGCATTCGGAGG 0: 1
1: 0
2: 0
3: 2
4: 102
1152995318_1152995324 13 Left 1152995318 18:401165-401187 CCAGCTATTCTCACCAATACGCC 0: 1
1: 0
2: 0
3: 4
4: 39
Right 1152995324 18:401201-401223 TTGGTACTATCTGCATTCGGAGG 0: 1
1: 0
2: 0
3: 2
4: 102
1152995319_1152995324 0 Left 1152995319 18:401178-401200 CCAATACGCCTCCTATGTTCTTT 0: 1
1: 0
2: 0
3: 4
4: 116
Right 1152995324 18:401201-401223 TTGGTACTATCTGCATTCGGAGG 0: 1
1: 0
2: 0
3: 2
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152995324 Original CRISPR TTGGTACTATCTGCATTCGG AGG Intronic
910178983 1:84460815-84460837 TTGGTACTATCTGCAGTTTCAGG - Intergenic
912920306 1:113860387-113860409 TTGGTACTATCTGCAGTTTCAGG + Intronic
913488089 1:119352278-119352300 TTGGTACTATCTGCAGTTTTAGG + Intergenic
913739349 1:121823155-121823177 TTCGTAGTATCTGCAATTGGAGG + Intergenic
913740344 1:121836289-121836311 TTCGTACTATCTGCAAGTGGAGG - Intergenic
913752809 1:122038079-122038101 TTCGTACTATCTGCAAGTGGAGG + Intergenic
915791395 1:158675531-158675553 TTGGTACTATCTGCAGTTTCTGG - Intronic
1064120867 10:12617542-12617564 TTTGTATTTTCTGCTTTCGGGGG + Intronic
1068722271 10:60259018-60259040 TTGATCCTGTCTGCATTCAGGGG + Intronic
1071461597 10:85902173-85902195 TTGGTACTATCTGCAGTTTCAGG - Intronic
1074307225 10:112290274-112290296 TTGGTACTATCTGCAGTTTCAGG + Intronic
1079775010 11:24514182-24514204 TAGTTACTCTCTGCATTCAGTGG - Intronic
1087869174 11:103270316-103270338 TTGGTACTATCTACAGTCCTAGG - Intronic
1091103768 11:132899532-132899554 TTGTTACTGTCTTCATTTGGAGG + Intronic
1092491898 12:8953098-8953120 TAGTTTGTATCTGCATTCGGTGG + Intronic
1093237168 12:16625059-16625081 TGGGTGCTATCTGCATTTAGTGG - Intergenic
1099550055 12:84032866-84032888 TTGGAACTACCTGCCTTCAGTGG + Intergenic
1103905381 12:124325021-124325043 TTGGTTCCAAATGCATTCGGGGG + Exonic
1106430282 13:29674457-29674479 TTGGTACTATCTGCAGTTTCAGG - Intergenic
1107525430 13:41226607-41226629 TTGGTTCTATCTTAATTTGGTGG - Intronic
1110828609 13:80003302-80003324 TTGGTACTATCTGCAGTTTCAGG - Intergenic
1112422164 13:99262295-99262317 TTGGTACTATCTGCAGTTTCAGG + Intronic
1117444932 14:55795087-55795109 TTGGTACCATCTGCACACGTAGG + Intergenic
1117611782 14:57490767-57490789 TTGCTACTAGCTTCTTTCGGTGG + Intronic
1117746196 14:58871905-58871927 TTGCTACTGTCTTCATTCTGAGG - Intergenic
1121740656 14:96249939-96249961 TTGGTACTATCTGCAGTTTCAGG + Intronic
1124200203 15:27672925-27672947 TTGGTGCATTCTGCATTGGGTGG - Intergenic
1124501244 15:30228205-30228227 TTGGTACTTTCTGAAATCTGAGG - Intergenic
1124742324 15:32310462-32310484 TTGGTACTTTCTGAAATCTGAGG + Intergenic
1126047257 15:44653786-44653808 TTGGTACTATCTGCAGTTTCAGG - Intronic
1127491958 15:59473432-59473454 TTGGTACTATCTGCAGTGTCAGG + Intronic
1130338984 15:82983247-82983269 ATGGTACCATGTGCATTCAGTGG - Intronic
1130545197 15:84852037-84852059 TTGGTACTATCTGCAGTGTCAGG - Intronic
1131409067 15:92190662-92190684 TTGGTACTATCTGCAGTTTCTGG - Intergenic
1142956034 17:3522962-3522984 TTGGTACTATCTGCAGTTTCAGG + Intronic
1146851310 17:36224146-36224168 TTGGTACTATCTGCAGTTTCAGG - Intronic
1146867222 17:36348019-36348041 TTGGTACTATCTGCAGTTTCAGG - Intronic
1147070097 17:37948630-37948652 TTGGTACTATCTGCAGTTTCAGG - Intergenic
1147081618 17:38028156-38028178 TTGGTACTATCTGCAGTTTCAGG - Intronic
1147097569 17:38152126-38152148 TTGGTACTATCTGCAGTTTCAGG - Intergenic
1149509163 17:57224042-57224064 TTGGTACTATCTGCAGTTTCAGG - Intergenic
1150079270 17:62222246-62222268 TTGGTACTATCTGCAGTTTCAGG - Intergenic
1152015642 17:77748693-77748715 TTGGTTCCATCTCCATTCTGAGG + Intergenic
1152995324 18:401201-401223 TTGGTACTATCTGCATTCGGAGG + Intronic
1153474898 18:5488733-5488755 TTGGTCCTATCTGGATTTAGAGG - Intronic
1160175434 18:76590348-76590370 TTGGAACGATCTGGATTTGGAGG - Intergenic
925055311 2:852764-852786 CTGGGAATATCTGCATTCTGTGG - Intergenic
926650186 2:15335289-15335311 TTGGTATTATCTTCAATCTGGGG - Intronic
932900626 2:75695596-75695618 TTGGTATTATTTGCATTCACTGG - Intronic
933774325 2:85762753-85762775 TTGGCACTATCGACATTTGGGGG + Intronic
934575694 2:95399725-95399747 TTGGTACTATCTGCAGTTTCAGG + Intergenic
934637878 2:96007615-96007637 TTGGTACTATCTGCAGTTTCAGG + Intergenic
934795781 2:97097803-97097825 TTGGTACTATCTGCAGTTTCAGG - Intergenic
940016904 2:149116296-149116318 TTGGTACTATCTGCAGTTCCAGG + Intronic
942173846 2:173312292-173312314 TTGATATTATCTGCATTTGCAGG - Intergenic
943306704 2:186271499-186271521 TTGGTACTATCTGCAGTTCCAGG - Intergenic
945281338 2:208038165-208038187 TTGGTTCCTTCTGCATTTGGGGG + Intergenic
947464643 2:230331334-230331356 TTGGTACTATCTGCAGTTTCAGG + Intronic
1174271936 20:49375950-49375972 TTGGAACTATGTGCTTTTGGGGG + Intronic
1181808328 22:25388763-25388785 TTGGTACTATCTTCATTACCTGG - Intronic
952784414 3:37138594-37138616 TTGGTACTATCTGCAGTTTCAGG - Intronic
955690425 3:61585410-61585432 TTGGTACTATAGCCATTGGGTGG + Intronic
956299432 3:67754165-67754187 TTGGTACTATCTGCATTTTCAGG - Intergenic
958537087 3:95418146-95418168 TTATTTCTATATGCATTCGGGGG + Intergenic
964071856 3:152645026-152645048 TTGGTACTATCTGCAGTGTCAGG - Intergenic
978261446 4:106765403-106765425 TTGGTACTATCTGCAGTTTTAGG + Intergenic
982744159 4:159089150-159089172 TTGGTACCATCTGATTTTGGGGG - Intergenic
984075195 4:175168187-175168209 TTGGTACTATCTGCAGTTTCAGG + Intergenic
995530916 5:113091197-113091219 TTTATACTATCTGCATACTGTGG + Intronic
998571450 5:143262424-143262446 TTGGTACTATCTGCAGTTTCAGG - Intergenic
1004703324 6:18099437-18099459 TTGGTACTATCTGCAGTGTCAGG - Intergenic
1006264186 6:32903599-32903621 TTGGTACTATCTGCAGTTTCAGG - Intergenic
1007184479 6:39957213-39957235 TTGGTACTATCTGCAGTTTTGGG + Intergenic
1009351645 6:62687741-62687763 TAGGCACTTTCTGCATTCAGTGG + Intergenic
1009605518 6:65862401-65862423 TTGGAACTATGTGCCTTCTGTGG - Intergenic
1011046742 6:83092613-83092635 TTGGTACTATCTGCAGTTTCAGG - Intronic
1013633524 6:112007866-112007888 TTGGTGTTATCTGCCTTGGGAGG - Intergenic
1014013905 6:116507632-116507654 TTGGTACTGTCTGCAGTTTGGGG + Intronic
1016141949 6:140623755-140623777 TTGGTACTATCTGCAGTTTCAGG + Intergenic
1017113465 6:150954158-150954180 TTGGTACTATAGGCATCCGTAGG - Intronic
1018504636 6:164451609-164451631 TTGGTACTATCTGCAGTTTCAGG + Intergenic
1019532453 7:1510684-1510706 TTGGTACTCACTGCACTCTGGGG - Intergenic
1021396492 7:20155289-20155311 TTGGTACTATCTGCAGTTTCAGG - Intronic
1022149710 7:27589033-27589055 TAGGAACTATCTGCATTTGCAGG + Intronic
1022247101 7:28571016-28571038 TTGGTACTATCTGCACTTTCAGG - Intronic
1030646720 7:112069824-112069846 TTGGTACTTTCTGTTTTAGGAGG - Intronic
1033880402 7:145874807-145874829 TTGGTACTATCTGCAGTTTCAGG + Intergenic
1034741095 7:153474255-153474277 TTGGTACTGTCTGCAGTTTGAGG + Intergenic
1036910031 8:12750365-12750387 TTGGTACTATCTGAAGTTGCAGG - Intronic
1041141007 8:54819667-54819689 GTGGTAGTATCTGCATTAGGGGG + Intergenic
1041773139 8:61494530-61494552 GTGGTAATCTCTTCATTCGGTGG - Intronic
1042769966 8:72368852-72368874 TTGGTACTATCTGCAGTTTCAGG + Intergenic
1044097021 8:88079450-88079472 CTGGTACTATCTGCAGTTTGAGG + Intronic
1046288142 8:112122737-112122759 TTGTTACTATCTACCTTTGGTGG - Intergenic
1046421599 8:113991447-113991469 TTGGTACTATCTGCAGTTTTGGG + Intergenic
1047045513 8:121048305-121048327 TTGGAAATAAATGCATTCGGTGG + Intergenic
1049181206 8:141223487-141223509 TTGGTACAGTCTGCATGTGGTGG - Intronic
1049741814 8:144244641-144244663 TTGGTGCTCTCTGCACTTGGGGG + Intronic
1055741690 9:79396723-79396745 TTGGTCCTCTGTGCATACGGTGG - Intergenic
1057892272 9:98878389-98878411 TTGGTACTATCTGCAGTTTCAGG + Intergenic
1190225675 X:48543091-48543113 TTGGTACTATCTGCAGTTTCAGG + Intronic
1190383864 X:49865382-49865404 TTGGTAACCTCTGCATTCAGGGG + Intergenic
1198052423 X:132961741-132961763 CTGGTTCTACCTGCATTCTGTGG + Intergenic
1198896032 X:141455511-141455533 TTGGTATTATCTCCATTTTGTGG - Intergenic
1201977242 Y:19865302-19865324 TTGGCACTTTCTGCTTTCAGGGG - Intergenic