ID: 1152995526

View in Genome Browser
Species Human (GRCh38)
Location 18:402811-402833
Sequence CTGAGTTACCACTTTGGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 200}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152995526 Original CRISPR CTGAGTTACCACTTTGGGGA AGG Intronic
900903155 1:5530728-5530750 ATGAGTTAAGACTTTGGGGAAGG + Intergenic
900964581 1:5948822-5948844 TCGAGTGACCACTTTGGGGCTGG - Intronic
900985363 1:6069989-6070011 CTTGGTCACCAGTTTGGGGAGGG - Intronic
903449656 1:23444255-23444277 CTGTTTTCCCTCTTTGGGGATGG + Intronic
903819233 1:26088578-26088600 CTGAGTGACAACCTTGGGGAAGG + Intergenic
906651755 1:47517711-47517733 GTGAGATACCACTGTGGGAATGG - Intergenic
907387359 1:54134656-54134678 CTGGGTGACCCTTTTGGGGAAGG + Intronic
907908562 1:58807388-58807410 CTGAGTTACAACCTCGGGGCTGG + Intergenic
908569383 1:65392703-65392725 CTGAGTGACCTGTTTGGGGGTGG + Exonic
909532003 1:76692303-76692325 CTGATTTTTCCCTTTGGGGATGG - Intergenic
909547923 1:76868180-76868202 GTGGGTTTGCACTTTGGGGAAGG - Intronic
909556463 1:76959841-76959863 CTGAGAACCCACTTTGGGCAAGG - Intronic
909642826 1:77886835-77886857 CTGAGTAAATACTGTGGGGATGG + Intergenic
910463357 1:87471162-87471184 CTGTGTTACCACTTGGAGAAGGG + Intergenic
912629501 1:111234462-111234484 ATGAGATACCACCTGGGGGATGG + Intronic
913445667 1:118948093-118948115 CTGAGTCACCACTGGGGAGATGG - Intronic
914352142 1:146849695-146849717 CTGGGTTACCACTTGGTGCATGG - Intergenic
916451200 1:164922130-164922152 CTGATTTAGCAATTTGGGGTGGG + Intergenic
917821450 1:178768182-178768204 CTGAGTTTCCATTTTGGTTAGGG + Intronic
919311887 1:195920025-195920047 CATAGTTATCACTTTGGTGATGG - Intergenic
921190433 1:212703563-212703585 CTGGATTACATCTTTGGGGAGGG + Intergenic
922438950 1:225635585-225635607 CTGAGTTTCCTCTTTGAGTATGG - Intronic
924392865 1:243581737-243581759 CTGAGTTTCCATTTTGGTTAGGG - Intronic
1065641966 10:27792199-27792221 CTGAATTACCACCTCTGGGAAGG + Intergenic
1067714390 10:48678085-48678107 CAGAGTCTCCACTTTGAGGAAGG - Intergenic
1068192419 10:53668431-53668453 CTGAGTTTCCATTTTGGTTATGG - Intergenic
1068227083 10:54119140-54119162 CTGAGTTTCCATTTTGGTTAGGG - Intronic
1069425958 10:68288895-68288917 CTGCATCAGCACTTTGGGGAGGG - Intronic
1072255716 10:93618521-93618543 GTGTGTTTCCACTTTGGGAAAGG + Intronic
1072385501 10:94921969-94921991 CTGAGTTCCCATTTTGGTTAGGG - Intergenic
1072389035 10:94963678-94963700 CTGAGTTGCCAGTTTGGTTAGGG + Intronic
1074263112 10:111873762-111873784 CTGAGTTACCACTTAAGACAGGG + Intergenic
1078636332 11:13053815-13053837 CTGAGCTACCACTTAGAGGGCGG + Intergenic
1078989447 11:16632076-16632098 CTGAGTTTCCATTTTGGTTAGGG + Intronic
1079721837 11:23825527-23825549 ACGAGTTAAGACTTTGGGGATGG - Intergenic
1081051688 11:38349637-38349659 ATGAGTTATGACTTTGGGGATGG - Intergenic
1082904060 11:58286755-58286777 CTGACTTTCCATTTTGGGTAGGG - Intergenic
1083016297 11:59457633-59457655 CTGAGATCCCACTCTGGGGAGGG + Exonic
1085788196 11:79473399-79473421 CCCAGGTGCCACTTTGGGGATGG + Intergenic
1089142355 11:116296109-116296131 CTGTCTCATCACTTTGGGGAAGG - Intergenic
1090360036 11:126165769-126165791 CTGACCTAACATTTTGGGGAAGG - Intergenic
1090622993 11:128578140-128578162 CCGGGTTGCCAGTTTGGGGAGGG - Intronic
1090630151 11:128638628-128638650 CTGAGTTTCCATTTTGGTTAGGG - Intergenic
1091139677 11:133224222-133224244 CTGAGTGACCCCTTTGGAGGTGG - Intronic
1091311767 11:134579918-134579940 TTGAGCTGCCACTGTGGGGAAGG - Intergenic
1092396109 12:8128301-8128323 CTGAGGATCCACTTTAGGGATGG + Intronic
1093134900 12:15438355-15438377 CTGAGTTTCCATTTTGGCTAGGG - Intronic
1093149209 12:15601827-15601849 CTGAATCACCACTTGGGGCAGGG + Intergenic
1093238462 12:16640397-16640419 GTGAGTTAAGACTTTGGGGCCGG - Intergenic
1095580268 12:43789037-43789059 ATGAGTTAAGACTTTGGGAAGGG + Intronic
1098528232 12:71511369-71511391 CTGATTTACCAGGTTGGGGTGGG - Intronic
1101362975 12:104045076-104045098 TTGAGTTCCCACCTTGGGGCAGG - Intronic
1102089006 12:110170592-110170614 CTGAATGACCACTCTGGGAAGGG - Intronic
1102448684 12:113024094-113024116 CTCAGTTAGCACTTTGGGACAGG - Intergenic
1104243767 12:127017260-127017282 CTGAGCTTCCACTTTTGGAAAGG - Intergenic
1106324839 13:28678983-28679005 TGGAGTTACAACTTTGGGGTTGG + Intergenic
1106446841 13:29841689-29841711 CTCAGTTACCGTTGTGGGGAGGG + Intronic
1107158418 13:37197358-37197380 CTGAGTTTCCATTTTGGTTAGGG + Intergenic
1107911987 13:45114145-45114167 CTGAGTTATCACTTGGTAGATGG + Intergenic
1108498670 13:51048898-51048920 CTGAGTTAACAAATGGGGGAAGG + Intergenic
1109309017 13:60671071-60671093 CTGAGTTTCCATTTTGGTTAGGG + Intergenic
1109646546 13:65265158-65265180 CTGAGTTTCCATTTTGGTTAGGG - Intergenic
1110189582 13:72715270-72715292 CTGATTTACCCATTTTGGGATGG + Intronic
1112727215 13:102318330-102318352 CTGAGTGCCCAGTTTGGGTAGGG - Intronic
1113188433 13:107716613-107716635 CTGCATATCCACTTTGGGGAAGG - Intronic
1114081434 14:19204142-19204164 CCAAGTTACCCCTTTGGGGATGG + Intergenic
1115055289 14:29118357-29118379 CTCACTAACGACTTTGGGGAAGG - Intergenic
1116332117 14:43610786-43610808 CTGAGTTTCCATTTTGGTTAGGG + Intergenic
1116781223 14:49240101-49240123 CTGAGTTTCCATTTTGGTTAAGG + Intergenic
1118038484 14:61892963-61892985 CTGAGTCACCACACTGAGGAAGG - Intergenic
1122451708 14:101813896-101813918 CTGAGTCACCAATTTGTTGAAGG + Intronic
1125130356 15:36277664-36277686 CTGAGTTTCCATTTTGGTTAGGG + Intergenic
1125251874 15:37713925-37713947 CTGATTTATCTCTTTGGGAATGG + Intergenic
1125453846 15:39837074-39837096 CTGAGTTATCAGTCTAGGGAAGG + Intronic
1126005290 15:44250754-44250776 CTGATTGAGCACTTTGTGGAAGG - Intergenic
1126820340 15:52496863-52496885 CTGAGTTGGCACAATGGGGATGG + Intronic
1127623729 15:60759671-60759693 CTGATTAACCACTTTTGGGTGGG + Intronic
1128568288 15:68715382-68715404 CTGATTTTCCACTTAAGGGAGGG - Intronic
1129955258 15:79630592-79630614 CTGTGTTGCCACTTTGGGGCTGG - Intergenic
1131308897 15:91269939-91269961 CAGAGTGACCACTCTAGGGATGG + Intronic
1134410523 16:14000072-14000094 CTGCGTTGCCACATTGGGGTGGG + Intergenic
1139105754 16:63824617-63824639 CTCAGTTACAACTTTGCTGAAGG + Intergenic
1139981888 16:70865837-70865859 CTGGGTTACCACTTGGTGCATGG + Intronic
1140766383 16:78163314-78163336 CTGAGTTTCCACTCTTGTGAAGG + Intronic
1143583520 17:7839739-7839761 TTGGATGACCACTTTGGGGATGG + Intergenic
1148408223 17:47439476-47439498 CTGAGTTTCCTCTTTGGTGTAGG + Intronic
1149876871 17:60243519-60243541 CTCATTCACAACTTTGGGGAAGG - Intronic
1152995526 18:402811-402833 CTGAGTTACCACTTTGGGGAAGG + Intronic
1153846174 18:9051659-9051681 ATGAGTTAAGACTTTGGGGGAGG + Intergenic
1156291832 18:35754574-35754596 CTCAGGAACCACCTTGGGGAGGG - Intergenic
1158849097 18:61476236-61476258 CAGAGTGATGACTTTGGGGATGG - Intronic
1161818951 19:6517153-6517175 CTGAGTTTCCTCTTGGGGGATGG + Intergenic
1167066874 19:47192922-47192944 CTGAGTAACCATTTTGGGGCAGG - Intronic
1168703815 19:58456773-58456795 CAGTGTTACCTCTTTGAGGATGG - Exonic
1168706331 19:58472339-58472361 CAGTGCTACCTCTTTGGGGATGG - Exonic
926105156 2:10145268-10145290 CCCAGTTACAACTTTCGGGATGG - Intronic
926275346 2:11399332-11399354 ATGAGTTAAGACTTTGGGGAAGG + Intergenic
926600988 2:14844930-14844952 CAGAGTTACCATTTGGGGGCTGG - Intergenic
927433854 2:23050056-23050078 GTGAGGTACCACTTTGGTGGAGG + Intergenic
927617344 2:24612884-24612906 CTGAGTTTCCATTTTGGTTAGGG + Intronic
928040689 2:27873367-27873389 CTGAGTAACTACTTTGAGCAAGG + Intronic
928919838 2:36515084-36515106 CTGTGTTGACTCTTTGGGGAGGG + Intronic
929932896 2:46272512-46272534 CTGAGTGAACAGTTTGGGAATGG + Intergenic
934810837 2:97275528-97275550 CCGAGTTCCCAAGTTGGGGAGGG + Intergenic
934826855 2:97432411-97432433 CCGAGTTCCCAAGTTGGGGAGGG - Intergenic
935805367 2:106741576-106741598 CTGACTTCTCATTTTGGGGATGG + Intergenic
936446505 2:112599965-112599987 CTGAGTTCCTCTTTTGGGGAAGG - Intergenic
941587448 2:167378818-167378840 CTGAGTTTCCATTTTGGTTAGGG + Intergenic
943200058 2:184811117-184811139 CAGATGTTCCACTTTGGGGATGG + Intronic
947357763 2:229314718-229314740 GTAAGTTTCCACTTTGGAGATGG - Intergenic
1169515678 20:6313318-6313340 CTGAGTTTCCATTTTGGTTAGGG - Intergenic
1170318087 20:15064198-15064220 CTCAGTTCCTACTTTGGTGAAGG - Intronic
1170351758 20:15449071-15449093 ATGAGCTGCCATTTTGGGGATGG - Intronic
1170486542 20:16821988-16822010 CTAAGTTTCCACTTTGGTTAGGG - Intergenic
1173460954 20:43243108-43243130 CTGAGCTAGCACAGTGGGGAGGG + Intergenic
1173836636 20:46130327-46130349 CTGAGATACTGCTTGGGGGAAGG - Intergenic
1175326382 20:58131368-58131390 CTGAGTGATCATTTTGCGGATGG + Intergenic
1175981736 20:62742176-62742198 CTGTGGGACCACTGTGGGGAGGG - Intronic
1176046722 20:63096775-63096797 CTGAGTGGCCACAGTGGGGATGG + Intergenic
1177288462 21:19080160-19080182 ATGAGTAAAGACTTTGGGGACGG + Intergenic
1178201333 21:30409390-30409412 CTGAGTTTCCATTTTGGCTAAGG - Intronic
1178785464 21:35649348-35649370 CTGAGTCACCACCTGGAGGAGGG + Intronic
1179138253 21:38699407-38699429 CTGCATCACCACCTTGGGGAGGG + Intergenic
1180499340 22:15918544-15918566 CCAAGTTACCCCTTTGGGGATGG - Intergenic
1181803060 22:25359675-25359697 CTGAATCAGCACTCTGGGGATGG + Intronic
1183036291 22:35143269-35143291 CTGAGTCACCACTTGGAGGAGGG + Intergenic
1183899451 22:40994031-40994053 CTGAGTTACTACGTTCGGGGTGG - Intergenic
949641818 3:6044472-6044494 GTGAGAATCCACTTTGGGGAGGG + Intergenic
949868946 3:8570605-8570627 GTGAGATATGACTTTGGGGATGG - Intergenic
949869086 3:8571546-8571568 GTGAGATATGACTTTGGGGATGG + Intergenic
950565649 3:13768217-13768239 CTCAGTTTCCACCTTGGGAAAGG - Intergenic
954943253 3:54394031-54394053 CAGAGTTACCACTATGAGGTAGG + Intronic
956129925 3:66043508-66043530 CTGAGTTACCTGTTTGGAGTCGG - Intergenic
956200561 3:66701321-66701343 CTGGGTTACCTCTTTGCAGATGG + Intergenic
959430794 3:106252401-106252423 CTGAGTTTCCACTTTGGTCGGGG - Intergenic
963605010 3:147406130-147406152 CTGCGTTGCCCCTTTGCGGAAGG + Intronic
963923820 3:150930495-150930517 CTCAGCTACCACTCTGAGGATGG - Intronic
964082388 3:152775127-152775149 CTTAGTAACCACATTGGGGTGGG - Intergenic
964919274 3:161876053-161876075 CTGAGTTTCCATTTTGGTTAGGG - Intergenic
966585772 3:181622584-181622606 CTGAGTTAACAGGGTGGGGATGG - Intergenic
967233039 3:187358975-187358997 CTGGGCTACCACTTGGGAGAGGG + Intergenic
967790680 3:193545678-193545700 TTGAGTTGGCACTTTGGTGAGGG - Intronic
970443496 4:16105296-16105318 CTGAGTTACAAATTTGCAGAAGG + Intergenic
975753763 4:77552083-77552105 CTGAGTTTCCATTTTGGTTAGGG + Intronic
976769067 4:88631827-88631849 CTGAGTTTCCAGTTCTGGGAAGG + Intronic
980021433 4:127714663-127714685 CTGAGTAGCCACTTTGATGAGGG - Intronic
981146970 4:141335076-141335098 CTTAGTTAGAACTTTGGTGAAGG + Intergenic
981666585 4:147233889-147233911 CTGATTTTCCACTGTGTGGAAGG - Intergenic
981987569 4:150875878-150875900 CTGAGTTTCCATTTTGGTTATGG - Intronic
982648747 4:158059248-158059270 CTGAATATCCACTTTGGGGAAGG + Intergenic
982965324 4:161899670-161899692 CTGAAATGCCATTTTGGGGAAGG + Intronic
983037462 4:162885423-162885445 CTGAATTAGCTCTTGGGGGAAGG - Intergenic
983903170 4:173158377-173158399 CTGCTTTTCCATTTTGGGGAGGG + Intergenic
986315046 5:6581641-6581663 CCGAGTTACCTGCTTGGGGAAGG - Intergenic
988753394 5:34216138-34216160 ATGAGCAAACACTTTGGGGATGG + Intergenic
988915675 5:35891582-35891604 CTGAGTAACTACTTGTGGGAGGG - Intergenic
991741177 5:69676984-69677006 ATGAGCAAACACTTTGGGGATGG + Intergenic
991756441 5:69877458-69877480 ATGAGCAAACACTTTGGGGATGG - Intergenic
991792751 5:70256721-70256743 ATGAGCAAACACTTTGGGGATGG + Intergenic
991820637 5:70553057-70553079 ATGAGCAAACACTTTGGGGATGG + Intergenic
991835843 5:70753371-70753393 ATGAGCAAACACTTTGGGGATGG - Intergenic
991885201 5:71257029-71257051 ATGAGCAAACACTTTGGGGATGG + Intergenic
992005301 5:72471550-72471572 CTGAGTTACCAATTTATGGAGGG + Intronic
993009210 5:82460181-82460203 CTGAGTTTCCATTTTGGTTAGGG - Intergenic
994127704 5:96187706-96187728 CTGAGTGCCCACTTTGTGCAAGG - Intergenic
996160683 5:120159494-120159516 CAAAGTTACAACTTTGGGTAAGG - Intergenic
997442500 5:133918773-133918795 GTGATTTAGCACTTTTGGGAAGG - Intergenic
997783788 5:136686781-136686803 CTGAGTTTCCATTTTGGCTAAGG - Intergenic
998380824 5:141724151-141724173 ATGAGTTAAAACTTTGGGGAAGG - Intergenic
999120603 5:149206705-149206727 CTTAGTTAGCAATTTGAGGAGGG + Intronic
999703397 5:154249210-154249232 CTGAATCACAACTTTGGGCATGG - Intronic
1001301424 5:170536534-170536556 CTTTGTTTCCTCTTTGGGGAGGG - Intronic
1001658374 5:173371723-173371745 CTGACTGACCACTTTGGAGCTGG - Intergenic
1003483167 6:6551950-6551972 TTGAGGTACCACATGGGGGAAGG + Intergenic
1004872005 6:19914741-19914763 CTGAGTTTCCATTTTGGTTAGGG - Intergenic
1006214821 6:32431419-32431441 CTGAGTTGTCACTTGGGGGATGG - Intergenic
1008087193 6:47257619-47257641 GATAGTTACCTCTTTGGGGAGGG + Intronic
1012675980 6:102114216-102114238 CTGAGTTTCCATTTTGGTTAGGG + Intergenic
1012849250 6:104427370-104427392 TTGAGTTACCTCTTTGGGTCAGG - Intergenic
1013030062 6:106324493-106324515 ATGAAGTTCCACTTTGGGGATGG - Intronic
1015107201 6:129550914-129550936 CTGAGTCCCCACTATGTGGAAGG - Intergenic
1015402272 6:132799866-132799888 CTGAGTTACCACTTTGTGCCAGG + Intergenic
1015833926 6:137399018-137399040 CTGATTTACCCCTTTGAAGAGGG - Intergenic
1016175505 6:141074048-141074070 CTGAGTTTCCATTTTGGTTAGGG + Intergenic
1016413075 6:143804108-143804130 CTGAGTTATGAATTTGGGAAGGG + Intronic
1016464615 6:144313307-144313329 CTGAGCTAGAACTGTGGGGATGG + Intronic
1017858969 6:158377678-158377700 CTGCGTGACCACATTTGGGATGG + Intronic
1021304540 7:19015797-19015819 CTGAGTTTCCATTTTGGTTAGGG + Intergenic
1023411381 7:39892186-39892208 CTGATTTGCCAGTTTGGAGATGG - Intergenic
1029002075 7:97164785-97164807 CTGATCTACCAATGTGGGGATGG + Intronic
1029946910 7:104542553-104542575 CCAAGATTCCACTTTGGGGAAGG - Intronic
1032856397 7:135837158-135837180 ATGAGCTCCCACATTGGGGAGGG + Intergenic
1037327949 8:17713191-17713213 GTGAGTGACCACTTTATGGATGG - Intronic
1039710307 8:40049558-40049580 CTCACTTACCACTAAGGGGATGG - Intergenic
1040332638 8:46397708-46397730 CTGTGATACCACTTTGTGGGGGG - Intergenic
1041786700 8:61642196-61642218 CTGATTTGTCACCTTGGGGAAGG - Intronic
1044259216 8:90098298-90098320 ATGAGTTCCCACTCTGGTGACGG + Intergenic
1045652403 8:104353351-104353373 CTGAGTCAACACTTTGGTGTGGG - Intronic
1046409206 8:113817305-113817327 CTGAGTTTCCATTTTGGTTAAGG + Intergenic
1048700105 8:137078704-137078726 ATGAGTTAAGATTTTGGGGAAGG + Intergenic
1048804735 8:138229538-138229560 CTGAGTTATCACTGTGGAAAAGG + Intronic
1049283348 8:141761658-141761680 CTGGGTTCCCACCTAGGGGAGGG + Intergenic
1051644058 9:19250522-19250544 ATGAGTTAAGACTTTGGGGTCGG - Intronic
1052622370 9:30930199-30930221 CTGTGTCCCCACTTAGGGGAGGG + Intergenic
1053056687 9:34997141-34997163 CTGAGTTGGCACTTTGGGGAAGG - Exonic
1055736375 9:79335607-79335629 CTGAGTTTCCATTTTGGTTAAGG + Intergenic
1056559007 9:87713623-87713645 CTGAGTGTCCGCTTTGAGGATGG - Intergenic
1057718380 9:97513659-97513681 CTGGGTACCCACTATGGGGAGGG - Intronic
1057891553 9:98873881-98873903 CTGATGTACCACTGTGGAGAGGG + Intergenic
1059434322 9:114267073-114267095 CTGAGTTATCACCGTGGGCATGG - Intronic
1059484098 9:114613661-114613683 CTGAGATGCTACTCTGGGGATGG - Intronic
1059890876 9:118802434-118802456 CTGAGTTTCCATTTTGGTTAGGG - Intergenic
1187197194 X:17099033-17099055 CAGAGTTGCCATTTTGGAGATGG - Intronic
1188023642 X:25186037-25186059 CTGAGTCACTACTTGGAGGAGGG + Intergenic
1189725437 X:43964110-43964132 CTAAGGTAGCACTCTGGGGACGG - Intronic
1191174318 X:57483511-57483533 CTGAGTTTCCATTTTGGTTAAGG + Intronic
1193026241 X:76849189-76849211 ATGAGTTAAGACTTTGGGGAAGG - Intergenic
1195000561 X:100639319-100639341 CTGCCTTACCACTCTGGGGCAGG - Intronic
1195415689 X:104617844-104617866 CTGAGTTTCCACTTTGGTTAGGG + Intronic
1198865556 X:141119826-141119848 ATGAGTTAACACTTTTGGGATGG - Intergenic
1199227312 X:145393288-145393310 CTGAGTTTCCATTTTGGCTAAGG + Intergenic