ID: 1152996676

View in Genome Browser
Species Human (GRCh38)
Location 18:413865-413887
Sequence AATTATGCTCAGTGGGGTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 161}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152996676 Original CRISPR AATTATGCTCAGTGGGGTTG GGG Intronic
908166435 1:61463581-61463603 TATTCTGCTTCGTGGGGTTGGGG - Intergenic
909709641 1:78633157-78633179 CACTATGCTCCCTGGGGTTGAGG - Intronic
910830005 1:91451342-91451364 ATGTATGCAAAGTGGGGTTGAGG + Intergenic
915496453 1:156285724-156285746 ACTTGCGCTCAGTGGGGTCGGGG - Exonic
916548003 1:165824997-165825019 CATTCTGCTCAGTGGGCCTGGGG + Intronic
916624121 1:166535079-166535101 ATATATGCCCAGTGTGGTTGGGG + Intergenic
916971526 1:170023464-170023486 AATTATCCTCAATGGAGTTAAGG + Intronic
917589654 1:176463158-176463180 AGTCATGCCCAGTGGGGTTCAGG - Exonic
918091921 1:181304094-181304116 AACTATGCTCAGTGAGGTAAAGG - Intergenic
920275502 1:204801568-204801590 AATTATGCTTATTGGGGTGGGGG + Intergenic
920929302 1:210371815-210371837 GAATATGCCCACTGGGGTTGGGG - Intronic
921418298 1:214916208-214916230 AATCCTGCTCAGGGGGGTTTAGG + Intergenic
921932898 1:220769631-220769653 AATCATGCTCAGGGAGGTTAAGG - Intronic
923145043 1:231191782-231191804 AATTATGCCCAGTGTGGGAGAGG + Intronic
923505502 1:234602105-234602127 AATTTTACTCAGTTGGGTTTTGG + Intergenic
924848465 1:247798046-247798068 AATTATGCCCAGTGGGGTGTGGG + Intergenic
1063988853 10:11537675-11537697 AAGTAGGGTCAGTGGGGCTGGGG + Intronic
1067311552 10:45118409-45118431 AATTATGCTAAATGTGGTTTAGG + Intergenic
1067804791 10:49385133-49385155 AATGTTGCTCTATGGGGTTGGGG + Intronic
1069213179 10:65787194-65787216 AATTCTTCTCAGTGGGGTGGTGG - Intergenic
1071195965 10:83160150-83160172 AATTATGATCAGTGTGGATGAGG + Intergenic
1072357619 10:94626676-94626698 ATTTAGACTCAATGGGGTTGAGG + Intergenic
1075244811 10:120811406-120811428 AAGTATGCTCAGTGCATTTGTGG - Intergenic
1075739859 10:124688373-124688395 GATAATGCTCAGTGGGGACGTGG - Intronic
1078000836 11:7494180-7494202 AATTGGGCTCAGTGTGTTTGTGG + Intronic
1079873503 11:25829523-25829545 AACAATGCCCAGTGGGGTTGTGG - Intergenic
1080156145 11:29113541-29113563 ATATATGCTCAGTGGGTCTGAGG + Intergenic
1080225009 11:29950348-29950370 AATGGTGGTCAGTGGTGTTGGGG - Intergenic
1081424283 11:42907927-42907949 ACTTATGCTCAGGGTGGTTGGGG - Intergenic
1081830384 11:46106473-46106495 AATTCTGCTCTGAGGTGTTGGGG + Intronic
1084631579 11:70355327-70355349 AGTAATGCTCAGGGCGGTTGTGG + Intronic
1085253021 11:75155901-75155923 AATAATGCTCACTAGGGTGGGGG + Intronic
1089762267 11:120736381-120736403 AGCTGTGCTGAGTGGGGTTGGGG + Intronic
1091116651 11:133019544-133019566 AATTATGTTCATTGGGTTTGGGG + Intronic
1091581196 12:1791031-1791053 CATTAAGCTCAGTGAAGTTGTGG - Intergenic
1094764316 12:33574463-33574485 AAATAGAGTCAGTGGGGTTGAGG + Intergenic
1095959298 12:47824079-47824101 AAGTATTCTGAGTAGGGTTGGGG + Intronic
1096166398 12:49428953-49428975 AATTTAGCTCAGTTGGGTTTGGG + Intronic
1097213486 12:57391306-57391328 AATTAAGCTAAGTGGGGCAGGGG + Intronic
1098351110 12:69561751-69561773 AATTATGGTGAGTGAGGTTTAGG + Intronic
1101250247 12:102926989-102927011 AGTAATAGTCAGTGGGGTTGCGG - Intronic
1102565622 12:113795558-113795580 AATGGTGCTCAGTGGGGAAGGGG - Intergenic
1106086442 13:26546560-26546582 AATTAGGCTGGGTGGGGTGGCGG + Intergenic
1108711655 13:53038929-53038951 AAGGATGCTCAGTGGTGTTCAGG - Intronic
1110605984 13:77433098-77433120 GATTTGGCTCAGAGGGGTTGAGG - Intergenic
1110760269 13:79223435-79223457 AATCATTCTCAATGGGTTTGGGG - Intergenic
1110772135 13:79361876-79361898 AGTGATTCTCAGTGGGGATGGGG + Intronic
1111109164 13:83684878-83684900 TATTATGCTGATTGGGGTTGGGG + Intergenic
1114143510 14:19945681-19945703 AACTATGCTCAGTAGTGTTATGG - Intergenic
1114536497 14:23426324-23426346 AATTAAGCCCAGAGGGGTTATGG + Intronic
1116115897 14:40650268-40650290 AATTATGGTGAGTGAGGTTTAGG + Intergenic
1118044311 14:61950132-61950154 AATCATTCCCAGTGGGGATGTGG - Intergenic
1123509364 15:20981090-20981112 AATTACACCCAGTGGGGATGGGG - Intergenic
1123566586 15:21554830-21554852 AATTACACCCAGTGGGGATGGGG - Intergenic
1123602847 15:21992123-21992145 AATTACACCCAGTGGGGATGGGG - Intergenic
1125592929 15:40866016-40866038 AATTCTGCTCACTGGGGATCTGG + Intergenic
1126756883 15:51933831-51933853 GATAATGCTCAGTGTGTTTGTGG - Intronic
1131677169 15:94682325-94682347 AATAATGCTCAAGCGGGTTGGGG + Intergenic
1202974947 15_KI270727v1_random:281925-281947 AATTACACCCAGTGGGGATGGGG - Intergenic
1133434556 16:5767830-5767852 AATTATGCTGAGTGAGGGGGAGG - Intergenic
1138986792 16:62338676-62338698 AAGTGTGGTGAGTGGGGTTGGGG - Intergenic
1144264481 17:13554955-13554977 CATTATTCTCAGGGGGCTTGAGG - Intronic
1145268517 17:21392042-21392064 ACTTATGCTGAGTGTGGTGGTGG + Intronic
1146757614 17:35447625-35447647 AGTTTTCCTCAGTGGGGTGGGGG - Intronic
1147603963 17:41763509-41763531 AATGAGGCTCAGAGAGGTTGGGG + Intronic
1149352792 17:55808849-55808871 AAATATGCTGGGTGGGGTTGAGG - Intronic
1149406470 17:56356957-56356979 AATTATGCACAGGGGGCTTTGGG - Intronic
1149747320 17:59111228-59111250 AACTATGCTAAGTGGGGGAGAGG - Exonic
1151930648 17:77229671-77229693 ACTGAGGCTCAGAGGGGTTGGGG + Intergenic
1151984940 17:77536203-77536225 AATTTTGCTCACTGTTGTTGTGG + Intergenic
1152539683 17:80968679-80968701 GGAGATGCTCAGTGGGGTTGGGG + Intergenic
1152996676 18:413865-413887 AATTATGCTCAGTGGGGTTGGGG + Intronic
1157910919 18:51616852-51616874 AATAATGATCAATGGGGCTGGGG - Intergenic
1159016748 18:63107115-63107137 AAGTATTCTCATTGGGATTGTGG + Intergenic
1160304699 18:77721297-77721319 AATTTTGCTCATTCGGATTGGGG + Intergenic
1162806247 19:13139317-13139339 AATTATGTACAGGGGGGTGGGGG - Exonic
1163417536 19:17195567-17195589 AATCATGCCCAGTGGGTGTGCGG + Intronic
1164860822 19:31560961-31560983 TTTTATGCTCAGTAGGGATGCGG + Intergenic
927590633 2:24354305-24354327 AATTGAGCCCAGTGGGATTGTGG + Intronic
927795768 2:26047345-26047367 AATTATGCTGAGTTGGGGGGTGG - Intronic
928127038 2:28624012-28624034 ACTTGAGCTCAGAGGGGTTGAGG + Intronic
930583731 2:53245338-53245360 CTTTGTGCTAAGTGGGGTTGGGG - Intergenic
931799385 2:65743688-65743710 AATGAAGCTCAGAGAGGTTGAGG + Intergenic
932674145 2:73763784-73763806 AATTATAGTAAGTGGGATTGAGG - Intronic
932775217 2:74524462-74524484 AAGTGTTCTCAGCGGGGTTGTGG - Intronic
933434191 2:82224602-82224624 AATTATGTTGAGTGGGTTTATGG + Intergenic
933655314 2:84881737-84881759 AAAAATCCTCAGTGGGGTTTTGG - Intronic
936249339 2:110855352-110855374 ACTAATGCTCAGAGAGGTTGAGG + Intronic
937214999 2:120306891-120306913 AATGATGCTCAGAGAGATTGAGG - Intergenic
938324552 2:130389889-130389911 CACTATGCTCAGTGGTGCTGCGG - Intergenic
944971578 2:204999606-204999628 AATGATTATCAGTGGGATTGTGG - Intronic
946247073 2:218393986-218394008 AAGTAGGCTCAGTGTGGTTAGGG + Intronic
1173642951 20:44616265-44616287 CATTATGCTCAGTGGGCTCATGG - Intronic
1174700250 20:52600778-52600800 CATTACGGTGAGTGGGGTTGGGG + Intergenic
1174904570 20:54536944-54536966 AATTCTGCTCAGTAGGAATGAGG + Intronic
1176186838 20:63784868-63784890 GATGATGCACAGAGGGGTTGGGG + Intronic
1177886352 21:26750570-26750592 AATTGTAGTCAGTGGGGTTTTGG + Intergenic
1178103303 21:29293339-29293361 AGTCATGATCATTGGGGTTGTGG + Intronic
1178163017 21:29940078-29940100 TATCTTGATCAGTGGGGTTGGGG - Intergenic
1181791120 22:25267249-25267271 AATTATTCTCTGTGGTGTGGTGG - Intergenic
1181826930 22:25524279-25524301 AATTATTCTCTGTGGTGTGGTGG - Intergenic
1183096351 22:35554461-35554483 GATAATTCTCAGTGGGGTGGGGG - Intergenic
951535320 3:23735359-23735381 CATTATGCTCTGTGGGGGTAGGG + Intergenic
951822187 3:26825687-26825709 AGCTAGGCCCAGTGGGGTTGGGG + Intergenic
952801133 3:37292915-37292937 AAATATGCTCAGAGATGTTGGGG + Intronic
952842964 3:37663985-37664007 ATTTATTCTCAGTGTTGTTGAGG - Intronic
952937794 3:38413670-38413692 AATTATGCCAAGTGAGTTTGGGG - Exonic
952946454 3:38481036-38481058 ATATATTCTCAGAGGGGTTGTGG - Intronic
953671663 3:44968008-44968030 AGTAAGGCTCAGAGGGGTTGGGG + Intronic
957249192 3:77751357-77751379 AATTTGGATCAGTGGAGTTGTGG - Intergenic
959126007 3:102290968-102290990 ACCTATGCTCCCTGGGGTTGGGG + Intronic
959716828 3:109442790-109442812 AATTGTGCTGCCTGGGGTTGAGG - Intergenic
962018377 3:131468528-131468550 AATTAGAATCAGTGAGGTTGTGG - Intronic
964528542 3:157642548-157642570 AATAATGCACAGTGCGGTTCAGG + Intronic
965350035 3:167600189-167600211 AATTGTGCTGCCTGGGGTTGGGG + Intronic
967395960 3:189009249-189009271 AAGTATGTTCATTAGGGTTGTGG + Intronic
972207733 4:36798389-36798411 AGTTGTGCTCCTTGGGGTTGGGG - Intergenic
972553805 4:40160944-40160966 CTTTATCCTCAGTGGGGATGGGG + Intergenic
975999906 4:80361365-80361387 ACTTCAGCTCAGTGAGGTTGTGG - Intronic
980789980 4:137608025-137608047 AATGATGCACTCTGGGGTTGGGG + Intergenic
983180669 4:164644649-164644671 AATTATGCTCAGTGCCACTGTGG - Intergenic
987445453 5:18012816-18012838 AAATATTCTTAGTGGGTTTGAGG + Intergenic
990503750 5:56424057-56424079 AGTTCTGCTCAATGGGTTTGAGG - Intergenic
991058407 5:62344504-62344526 GATAATGCTCAGTGTTGTTGAGG + Intronic
992035715 5:72773673-72773695 AATTAAGCTCAGTATGGTTTTGG - Intergenic
992070660 5:73145549-73145571 ACTTGCCCTCAGTGGGGTTGGGG - Intergenic
993833575 5:92789084-92789106 AGTTATGCTGAGTGGGTATGTGG + Intergenic
999891103 5:155979620-155979642 AATTATGCCTAGTGGAGGTGAGG + Intronic
1002781183 6:367998-368020 AATGGTGCTCAGTGGTGCTGGGG - Intergenic
1008848638 6:55997357-55997379 AGTTGTGCTGACTGGGGTTGGGG + Intergenic
1010510017 6:76706882-76706904 TATTATTCTCAGTGGGACTGTGG + Intergenic
1011290501 6:85772173-85772195 AATAAGGCTCAGAGGGGTTGGGG + Intergenic
1011891134 6:92161348-92161370 AATTCTACTCAGTGGAGGTGAGG + Intergenic
1012536352 6:100302135-100302157 AATTTTCATCAGTGGGGTAGTGG - Intergenic
1012792774 6:103719972-103719994 AATTATGTTCAGTAGGTTTTGGG - Intergenic
1018351545 6:162965019-162965041 AAGCATGCCCAGTGGGGCTGTGG + Intronic
1019375438 7:689047-689069 AATTCTGCTCAGTATGTTTGAGG + Intronic
1019732097 7:2634090-2634112 AATTCTGCTCTGTGGAGATGAGG - Intronic
1021096954 7:16546495-16546517 AATGATTCTCAGTGGAGGTGGGG - Intronic
1022550316 7:31232660-31232682 AATTATGCTCACTGTGTTTCTGG + Intergenic
1024172786 7:46807905-46807927 AATTATGCTCAGTGAAGTGGAGG + Intergenic
1024613273 7:51085190-51085212 CCTTATCCTCAGTGCGGTTGGGG + Exonic
1029737468 7:102472699-102472721 GATTGTGCTCTGTGGGGATGAGG + Exonic
1029891122 7:103931521-103931543 GACTATGCTCAGTGGTGTTGGGG - Intronic
1031546291 7:123054297-123054319 AGTTATGCTGCTTGGGGTTGGGG + Intergenic
1031937482 7:127750472-127750494 TACTACCCTCAGTGGGGTTGTGG + Intronic
1031963371 7:128009389-128009411 AATTATCCTCAAAGGGGTTTCGG + Intronic
1032062733 7:128738637-128738659 AATTATGCTTAGTGAGGTCAGGG + Intergenic
1038042481 8:23736419-23736441 AATAATGTTCTGTGGGATTGGGG + Intergenic
1041465796 8:58156348-58156370 AATTCTGCTCACTGGGGCAGAGG + Intronic
1043606115 8:82002513-82002535 AATTATGCTCAGTGGGAGTATGG - Intergenic
1046507808 8:115158781-115158803 CATTCTTCTCAGTGGGTTTGTGG + Intergenic
1046833586 8:118775210-118775232 AAGTATGATCAGAGAGGTTGAGG - Intergenic
1047009618 8:120657320-120657342 AAGTTTTCTCAGTGGAGTTGGGG + Intronic
1048617706 8:136095916-136095938 AATTATGGTGAGTTTGGTTGGGG + Intergenic
1050238882 9:3613276-3613298 AACTATGCTTCCTGGGGTTGGGG + Intergenic
1052228513 9:26119054-26119076 TCTGATGCTCAATGGGGTTGGGG + Intergenic
1052989294 9:34509538-34509560 AACTATGCTCAGGGGGGTAGAGG - Intronic
1053631358 9:39943732-39943754 CATTATGCTCAGTGTGTGTGTGG + Intergenic
1053774407 9:41519799-41519821 CATTATGCTCAGTGTGTGTGTGG - Intergenic
1054212529 9:62306966-62306988 CATTATGCTCAGTGTGTGTGTGG - Intergenic
1054750259 9:68898201-68898223 AATTGGGCTCAGCAGGGTTGAGG - Intronic
1055009027 9:71543099-71543121 AATGATGTTGAGTGGTGTTGAGG - Intergenic
1056394483 9:86168883-86168905 AATGGTGGTCAGTGGGGTAGGGG + Intergenic
1056619222 9:88196601-88196623 ATTTATTCTCACTGGGGTGGAGG + Intergenic
1059521322 9:114944764-114944786 AACTATGCACATTTGGGTTGTGG + Intergenic
1060276129 9:122184165-122184187 AAACAGGCTCAGTGGGGTTAAGG + Intronic
1061621720 9:131814916-131814938 AAGGGTGCTCAGTGGGGGTGAGG - Intergenic
1062554495 9:137107833-137107855 CATGAAGCTCAGTGGGGATGGGG - Intronic
1186581198 X:10820786-10820808 AATGATGCTCAGAGTGGTCGGGG - Intronic
1191258719 X:58291234-58291256 CACTGTGCCCAGTGGGGTTGTGG + Intergenic
1196948969 X:120857117-120857139 AAATAGGCTCAGTGTTGTTGGGG + Intergenic
1198213762 X:134538035-134538057 AAGTATGCCAAGAGGGGTTGAGG - Intergenic
1198834488 X:140788158-140788180 GATGATGGTCACTGGGGTTGAGG + Intergenic
1198848696 X:140941643-140941665 AATTGTGCCTAGTGTGGTTGAGG - Intergenic
1199143578 X:144338154-144338176 AAGGATGCTCAGTGAGGTTAGGG + Intergenic