ID: 1153000348

View in Genome Browser
Species Human (GRCh38)
Location 18:449746-449768
Sequence CCATGAGGGCAGAAGTGACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 279
Summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 244}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153000348_1153000354 -8 Left 1153000348 18:449746-449768 CCAGGTCACTTCTGCCCTCATGG 0: 1
1: 0
2: 2
3: 32
4: 244
Right 1153000354 18:449761-449783 CCTCATGGGGCCCTTCTGACAGG 0: 1
1: 0
2: 0
3: 12
4: 145
1153000348_1153000357 8 Left 1153000348 18:449746-449768 CCAGGTCACTTCTGCCCTCATGG 0: 1
1: 0
2: 2
3: 32
4: 244
Right 1153000357 18:449777-449799 TGACAGGCAATCTCTGCTCCCGG 0: 1
1: 0
2: 0
3: 16
4: 163
1153000348_1153000358 9 Left 1153000348 18:449746-449768 CCAGGTCACTTCTGCCCTCATGG 0: 1
1: 0
2: 2
3: 32
4: 244
Right 1153000358 18:449778-449800 GACAGGCAATCTCTGCTCCCGGG 0: 1
1: 0
2: 1
3: 18
4: 175
1153000348_1153000359 24 Left 1153000348 18:449746-449768 CCAGGTCACTTCTGCCCTCATGG 0: 1
1: 0
2: 2
3: 32
4: 244
Right 1153000359 18:449793-449815 CTCCCGGGCACCCATGTACCTGG 0: 1
1: 0
2: 2
3: 10
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153000348 Original CRISPR CCATGAGGGCAGAAGTGACC TGG (reversed) Intronic
900081770 1:863935-863957 CCATGAAGGCAGCGGTGTCCAGG + Intergenic
900950461 1:5855633-5855655 GGATGTGGACAGAAGTGACCCGG - Intergenic
900993046 1:6106727-6106749 ACATGAAGGCCGACGTGACCCGG - Exonic
903296469 1:22346395-22346417 CCATGGGAGCAGAAGGGACGGGG + Intergenic
903849393 1:26297044-26297066 CCCTCAGGGCAGAGGTGACCTGG - Intronic
904956019 1:34284562-34284584 CAATGTGTGCAGAAGTCACCAGG - Intergenic
904993383 1:34612228-34612250 GCATGAGGAGAGAGGTGACCCGG + Intergenic
906120287 1:43385288-43385310 CCAGGAGGAAAGAAGTGACATGG + Intronic
908728287 1:67199735-67199757 CCATGAAGGCAGAAGTGTTCAGG + Intronic
908794289 1:67816071-67816093 CACTGAAGGCAGAAGGGACCAGG - Intronic
909407777 1:75311901-75311923 CCCTGAGGGCAGGTGAGACCAGG + Intronic
909496567 1:76285649-76285671 TCATGAGGGCAGAAGTGACTAGG + Intronic
910280300 1:85493004-85493026 CCATGAAGGCAAAAGTTTCCAGG - Intronic
911256070 1:95634810-95634832 CCATGAAGGCAGAAGCACCCAGG - Intergenic
911410357 1:97497106-97497128 CAAGCAGGGCAGAAGTGAGCAGG + Intronic
913970937 1:143417182-143417204 TCATGATGGCAGAATTGTCCAGG + Intergenic
914065315 1:144242793-144242815 TCATGATGGCAGAATTGTCCAGG + Intergenic
914113836 1:144723561-144723583 TCATGATGGCAGAATTGTCCAGG - Intergenic
916145913 1:161739200-161739222 CCATAAGGGCGGATGTGGCCAGG + Intergenic
916204741 1:162305313-162305335 CCATGATGTTAGAGGTGACCGGG - Intronic
916637999 1:166694800-166694822 CCATGAAGGCAGAAGTCAGATGG - Intergenic
917284062 1:173406495-173406517 CCATGAAGGCAAAAGTGCCTAGG - Intergenic
917296268 1:173522678-173522700 CCACTAAGGCAGAAGTGCCCAGG + Intronic
918251997 1:182711138-182711160 GCATCAGGCCAGAAGTGAACAGG + Intergenic
919648862 1:200125420-200125442 CCATGAGGACAAAACTTACCTGG - Intronic
920019475 1:202943809-202943831 CAATGATGGCAGAAATGCCCAGG + Exonic
920676237 1:208040397-208040419 CCCTGAGGCCAGAAGTGAGTTGG - Intronic
921805397 1:219448499-219448521 TAATGAGGGCAGAGGTGGCCTGG - Intergenic
922111381 1:222560016-222560038 CCATGAGAGCTGAAGTCACAGGG + Intronic
922998587 1:229986867-229986889 CCAAGAGGGCAGGACTGATCTGG - Intergenic
923375839 1:233361886-233361908 CCATGAGGACCTGAGTGACCAGG + Intronic
924022618 1:239800299-239800321 ACAAGAAGGCAGCAGTGACCTGG - Intronic
924198684 1:241638274-241638296 ACAGGAAGGGAGAAGTGACCAGG + Intronic
1063065753 10:2606609-2606631 CTATGAGGGCAGAATTCTCCAGG - Intergenic
1063188950 10:3675946-3675968 CCAAGAAGACACAAGTGACCAGG + Intergenic
1063434577 10:6019808-6019830 CCAAAAGGGCAGAGGTGACCAGG - Intronic
1068154391 10:53178262-53178284 GCATGTGGGTAGAAGAGACCTGG + Intergenic
1069743856 10:70702524-70702546 GCTTAAGGACAGAAGTGACCGGG - Intronic
1073257045 10:102159325-102159347 CTGTCAGGGCAGAGGTGACCAGG + Exonic
1075518909 10:123132395-123132417 CCAAGAGGGCAGAAGGGGACTGG - Intergenic
1076506986 10:130984779-130984801 CCATGAGGGCAGCAGAGCACAGG + Intergenic
1077139035 11:1015468-1015490 CCAGGAGTGCAGCAGTGACCGGG + Intronic
1078420688 11:11209604-11209626 CCATGAGAGCAGAAGGGCTCAGG + Intergenic
1079069346 11:17329413-17329435 CCATGCGGGCTGAAGTGCTCTGG - Intronic
1084327019 11:68406373-68406395 CCATGAGGTCGGACCTGACCCGG + Intronic
1085134953 11:74078287-74078309 CCAAAAGAGCAGAAGTCACCAGG - Exonic
1087239094 11:95755468-95755490 GCAGGAGGATAGAAGTGACCGGG + Intergenic
1087910477 11:103747533-103747555 CCAGGAGGGCAGGAGTAAGCAGG + Intergenic
1087972671 11:104504152-104504174 CTATGATGGCAGAAGGCACCTGG + Intergenic
1088021918 11:105130331-105130353 CCATGGGGGCAGATCTGCCCAGG - Intergenic
1090081199 11:123614044-123614066 CCATGCGGGTTGAAGTGAACGGG - Intronic
1090975200 11:131674047-131674069 CCATGAGGTCAGAAGTATCAAGG - Intronic
1091371944 11:135068155-135068177 CCCTGGGAGCAGAAGTGTCCAGG - Intergenic
1093982661 12:25491745-25491767 CCAGGAGGTCATTAGTGACCAGG + Intronic
1098154443 12:67582813-67582835 CCATGAAGGCAAAAGTGCCTGGG - Intergenic
1101998887 12:109544399-109544421 CCATGAGGCCAAAGGTGAGCAGG + Intergenic
1103486783 12:121288453-121288475 CCTAGAGGGCAGAACTGTCCAGG + Intronic
1103536763 12:121638805-121638827 CCATGAGGGCTGGAGGGACAGGG - Intronic
1104217232 12:126746016-126746038 CCCTGAGGGCAGGAGTCCCCCGG - Intergenic
1104637315 12:130446491-130446513 CCATGAGGGGCCACGTGACCTGG - Intronic
1106247527 13:27962216-27962238 CCATGGGGGGAGAAGTGATATGG - Exonic
1106358214 13:29005128-29005150 ACCTGATGGCAGAAGTGGCCGGG - Intronic
1108575153 13:51784177-51784199 CCTTGAGGGCAGAATCCACCTGG - Intronic
1109023924 13:57136246-57136268 CAATGTGAGCAGAAGTGACAAGG + Intergenic
1111064011 13:83066278-83066300 CCAGGAGTGAAAAAGTGACCAGG - Intergenic
1111898258 13:94168568-94168590 CCATGAAGGCAAAAGTGCCCAGG - Intronic
1112870263 13:103962519-103962541 TCATTAGGGCAGAAATGACTAGG - Intergenic
1113242912 13:108359831-108359853 GTATGAGGACAAAAGTGACCTGG + Intergenic
1113592930 13:111513279-111513301 CTCTGAGGGCAGAAGGGACTTGG + Intergenic
1118318020 14:64737438-64737460 CAATGAGGGCTGAAGGGGCCGGG - Intronic
1120388405 14:83874922-83874944 CCATGAAGGACTAAGTGACCAGG - Intergenic
1121923370 14:97904440-97904462 CCATGAAGGAAGAAGAGACAGGG + Intergenic
1122402544 14:101475750-101475772 CTCTGAGGGCAGGAGTGATCTGG - Intergenic
1122952192 14:105051126-105051148 CCATGAAGACAGACGTCACCAGG - Exonic
1123006416 14:105325933-105325955 GCATCAGGACAGAGGTGACCAGG + Intronic
1124649572 15:31464945-31464967 ACAGGAAGCCAGAAGTGACCAGG - Intergenic
1125506753 15:40271764-40271786 CCATGGGGGCAGAAGAGGCCTGG - Intronic
1127374330 15:58369208-58369230 CCATGAGGGTACAAGTGAGCTGG - Intronic
1127563509 15:60163884-60163906 CCATGAAGGCAAAAGTGCCTAGG + Intergenic
1128312021 15:66636756-66636778 CCAACAGGGCAGAAATGACATGG + Intronic
1128448342 15:67784774-67784796 CCATGATGGCAGAAGTGGAAAGG - Intronic
1130656087 15:85793134-85793156 CCGTGTGGGCAGAAGAGAGCAGG - Intronic
1130717583 15:86350857-86350879 CCATTAGGGCATAAGCCACCAGG - Intronic
1131972180 15:97903942-97903964 CCATCCTGGCAGAAGTGTCCAGG + Intergenic
1132466846 16:81510-81532 CCATGAGGACAGAAGTGAACAGG - Intronic
1133342430 16:5045331-5045353 CCATGAGGTCACACGGGACCAGG - Intronic
1133386880 16:5376961-5376983 CCCTGAGTGCAGAAGAGACTTGG - Intergenic
1138061740 16:53898513-53898535 CCATGAGGGCAGCAGGGACTTGG + Intronic
1138533571 16:57647923-57647945 CCAGGAGGGCTGAAGTGACACGG + Intronic
1139915478 16:70425821-70425843 CCACAAGGGCAGAAGTGGTCCGG + Intronic
1141369385 16:83473002-83473024 CCATGGGGGCACAGGTGGCCTGG + Intronic
1141592454 16:85077756-85077778 CCGTGGGGGCAGAAGTGGCTGGG - Intronic
1141626402 16:85263899-85263921 CCAGGACGGCAGAGGAGACCTGG - Intergenic
1142354203 16:89594447-89594469 CACTGAGGGCAGATGTGTCCTGG - Intronic
1143433097 17:6901240-6901262 AGATAAGGGCAGAAATGACCTGG + Intronic
1145813618 17:27780430-27780452 GCAGGAGGGCAGAAGAGGCCTGG + Intronic
1148438105 17:47697572-47697594 GGGTGAGGGCAGAGGTGACCAGG + Intronic
1148458880 17:47826431-47826453 CCTCCAGTGCAGAAGTGACCTGG + Intronic
1150815790 17:68390957-68390979 CCACGAAGGCAGAAGTGCCCAGG + Intronic
1151730129 17:75906124-75906146 ACACAAAGGCAGAAGTGACCTGG + Intronic
1151780965 17:76245150-76245172 GAATGAAGGCAGAAGTGAACAGG - Intergenic
1152358352 17:79817458-79817480 CCGTGAGGCCAAAAGTGGCCGGG - Intergenic
1153000348 18:449746-449768 CCATGAGGGCAGAAGTGACCTGG - Intronic
1153127424 18:1811442-1811464 CAATAAGGGCAGTAGTGGCCAGG - Intergenic
1153757064 18:8294891-8294913 GCCTGAGGGCAGAACAGACCTGG + Intronic
1154467055 18:14656115-14656137 TCATGAGGTCAGGAGTTACCTGG - Intergenic
1156201319 18:34835464-34835486 CTTTGAGGGAAGAAGGGACCTGG + Intronic
1156371691 18:36477042-36477064 CCATGTGGGCAGGAGTTATCTGG + Intronic
1156526644 18:37774288-37774310 CCATGAGGGCAGGAGCAGCCAGG - Intergenic
1159914712 18:74178365-74178387 CCATGAGGGCTAAGCTGACCAGG + Intergenic
1160562355 18:79766623-79766645 CCATGAGGGCCGCAGGGTCCGGG - Intergenic
1161558520 19:4957823-4957845 CCCTGGGGGCAGAACTGCCCAGG + Intronic
1163586705 19:18168326-18168348 ACAAGAGGGCAGAGCTGACCTGG - Intronic
1163716263 19:18874160-18874182 CCAAGAAAGCAGAAGTGGCCGGG - Intronic
1163827170 19:19530190-19530212 CCAGGAGGCCTGAAGTGGCCTGG - Intronic
1165890106 19:39106852-39106874 CCTTGAGGGCAGCAGGGTCCTGG + Intronic
1166825740 19:45607783-45607805 CCCTTAGGGCAGAAGGGACAGGG - Intronic
1167431427 19:49457219-49457241 GCATCAGGGAAGACGTGACCAGG + Intronic
1168286472 19:55337183-55337205 CCATGCCGGCAGAAGGGAACTGG - Intergenic
1168294545 19:55372470-55372492 GCATGGGGGCAGAGGAGACCCGG + Intergenic
926356124 2:12042294-12042316 CACTTAGGGCAAAAGTGACCTGG + Intergenic
928683417 2:33725946-33725968 TCATGAGGGCAGAAATTACTAGG - Intergenic
928962014 2:36936950-36936972 TCATGATGGCAGAATTGTCCAGG + Intronic
928987031 2:37191791-37191813 ACATGAGGGAAGGAGTGACAGGG + Intronic
929456465 2:42069555-42069577 CCAGGAGGGCAGAAGGGAGAAGG - Intergenic
929781639 2:44961022-44961044 CAAGGAGGGCAGAACTGGCCAGG - Intergenic
929928908 2:46237087-46237109 TCATGAGGACAGAGGGGACCTGG - Intergenic
931124041 2:59253776-59253798 CCATAAGTGCAGAAGTGAAATGG + Intergenic
931244421 2:60480487-60480509 CCATGGAGCCAGCAGTGACCAGG + Intronic
931908645 2:66870183-66870205 AGATGAGGTCAGAAGTGGCCAGG + Intergenic
932309626 2:70729163-70729185 GCATGAGGGAAGGAGTGCCCTGG - Intronic
932732675 2:74232113-74232135 CCATCAGGGCAGTAGGGGCCTGG + Intronic
934175636 2:89578105-89578127 TCATGATGGCAGAATTGTCCAGG + Intergenic
934285952 2:91652470-91652492 TCATGATGGCAGAATTGTCCAGG + Intergenic
936153215 2:110032847-110032869 CCCTGGGGGCAGTAATGACCTGG + Intergenic
936153492 2:110034002-110034024 CCAGCAGGGCAGAAATGACCCGG + Intergenic
936191189 2:110337413-110337435 CCAGCAGGGCAGAAATGACCCGG - Intergenic
936191466 2:110338568-110338590 CCCTGGGGGCAGTAATGACCTGG - Intergenic
937231391 2:120400076-120400098 CCATGAGGTCAGCAGTGGCAGGG + Intergenic
938782846 2:134600990-134601012 CTATGAAGGCAAAAGTGTCCAGG - Intronic
939646473 2:144705411-144705433 CCATGTGGGCTGAAGTTTCCAGG - Intergenic
939940732 2:148347833-148347855 CCATGATGGCAGAAGTACCTAGG + Intronic
940385527 2:153066895-153066917 CACTGAGAGCAAAAGTGACCAGG - Intergenic
940791067 2:158030889-158030911 CCAAGAGGTCAGAAGAGAACAGG - Intronic
943117217 2:183688460-183688482 ACATGAGGGCAGAACTTGCCAGG - Intergenic
943762396 2:191624015-191624037 AAATGAGGACAGAAGGGACCAGG - Intergenic
947878850 2:233486966-233486988 CCTTGAGAGCAGGAGTGCCCTGG + Intronic
947915691 2:233830547-233830569 CTATGAGGGCAGCAGTTTCCAGG + Intronic
947922433 2:233888918-233888940 CCATGAAGGCAAAAGTACCCAGG + Intergenic
948015431 2:234686425-234686447 CGATGTGGGCAGAACTTACCAGG - Intergenic
948385794 2:237579845-237579867 ACATGCGGGCAGAAGAGCCCAGG - Intronic
948422951 2:237871619-237871641 CCCAGAGGGTAGAAGTGCCCAGG - Intronic
1171235224 20:23519143-23519165 GCCAGAGGGCAGAAGTGCCCTGG + Intergenic
1173199579 20:40944706-40944728 CCATGAAGGCAGAAGCGTCTAGG + Intergenic
1173618585 20:44419146-44419168 CCATGAAGGCACAGGTGACGCGG - Intronic
1173701472 20:45075657-45075679 ACATGAGGGCAGAGGACACCGGG + Exonic
1175412900 20:58783207-58783229 CCAACAGAGCAGAAGTGTCCAGG + Intergenic
1175642495 20:60642728-60642750 CCATGAATGCAGCAGTGACAGGG + Intergenic
1175716986 20:61261739-61261761 CCATAAGACCAGCAGTGACCAGG + Intronic
1175973117 20:62697127-62697149 CCGTGAGGAGAGAAGTGGCCAGG - Intergenic
1178162836 21:29939201-29939223 CCAGGAGGGAAGCAGTGACGCGG + Intronic
1178546293 21:33495619-33495641 CAAAGAGTGGAGAAGTGACCAGG - Intergenic
1178799225 21:35776963-35776985 CCATCATGGCAGAAGTGCCAAGG - Intronic
1178952715 21:36998380-36998402 CCATGAGGGCAGAACTCTCATGG + Intergenic
1179915802 21:44477374-44477396 CCCTGAGGGCTGAAGGGCCCTGG + Intergenic
1180866162 22:19121152-19121174 CCATGAAGGCAGAAGTGCCAGGG - Intronic
1180932170 22:19599753-19599775 CCTTGAGGGCAGCAGTGCTCAGG - Intergenic
1181151158 22:20884430-20884452 TGATGAGGGCAGAAGGGACTAGG - Intronic
1181273312 22:21673412-21673434 CCATGAGGGCAGCTGTGGACAGG - Intronic
1183485082 22:38084223-38084245 CCAGGAGGGGAGAAGAGACTGGG + Intergenic
1183835785 22:40451915-40451937 GCAGGAGGGCACAGGTGACCTGG - Intronic
1184976710 22:48067340-48067362 TCATGTGGGAAGAAGTGGCCGGG + Intergenic
1185253887 22:49821098-49821120 ACATGGGGGCTGAAGTGGCCAGG - Intronic
951698973 3:25475673-25475695 CCATGAGAGGAGAGGTGACTTGG - Intronic
953772898 3:45792480-45792502 CCAACAGGGCAGATGTTACCAGG + Intronic
953824672 3:46240519-46240541 CCATGTGGGCTGAAGGGACTGGG - Intronic
956114425 3:65904228-65904250 CCATGAGGGCAAGAATGGCCTGG + Intronic
956445344 3:69320814-69320836 CCATGAGGGGAGAAGGTAGCGGG - Intronic
959531738 3:107441158-107441180 CCATGATGGCAAAAGTGCCTAGG - Intergenic
961305935 3:125959161-125959183 CCGTGAGGCCAGGAGGGACCTGG - Intergenic
961861394 3:129919217-129919239 CCAGGAAGCAAGAAGTGACCTGG + Intergenic
964506756 3:157408007-157408029 CGATGAGGGCAAAAGTAACACGG - Intronic
964569955 3:158099653-158099675 CCATGAGGACAGAAGGGACTAGG + Intronic
965058332 3:163749944-163749966 GCTTGAGGGCAGCAGTGGCCAGG - Intergenic
966688712 3:182722998-182723020 CCCTGGGGACAGAAGTCACCTGG - Intergenic
966730421 3:183146437-183146459 CCATTAGGGCAGAAGTCACAGGG + Intronic
968041908 3:195595933-195595955 CCATGTGAGCGGAAGTGACTAGG + Intergenic
969020986 4:4140138-4140160 CCCTAAGGGCAGAAGTGAAGAGG - Intergenic
969462764 4:7337510-7337532 CCCTGAGGGCAGCGGAGACCTGG + Intronic
969946469 4:10788313-10788335 CTTTGTGGGCAGAAGTGACAAGG + Intergenic
973107201 4:46354949-46354971 CCATGAGAGGAGAAGAGATCTGG + Intronic
976151996 4:82101645-82101667 CCGTTAGGGCTGAAGGGACCAGG + Intergenic
976332309 4:83846529-83846551 CCATGAGGGAAGATGTGAGTGGG + Intergenic
978827878 4:113046589-113046611 CCATCTGGGAAGAAGAGACCTGG + Intronic
981485149 4:145277966-145277988 CCATGAAGGCAAAAGTGTCTAGG + Intergenic
983526330 4:168763816-168763838 CCATCAGGTCAGGAGTGACCAGG + Intronic
989825265 5:45847681-45847703 CCATGAAAGCACAAGTGATCAGG + Intergenic
991259259 5:64649729-64649751 CTAGCAGGGCAGAAGTGTCCTGG - Intergenic
991535976 5:67669629-67669651 CCATGGGGGCAGAGATGCCCAGG + Intergenic
991613713 5:68474546-68474568 CCTAGAGGGCACAAGTGACAAGG - Intergenic
992875552 5:81050927-81050949 CCATTAGGGCAGAAGAAAGCTGG + Intronic
995394901 5:111677069-111677091 GAATGAGAGCAGAAGTGACATGG + Intronic
995704817 5:114977312-114977334 TCATGAGGGCAGAAGTATCATGG + Intergenic
995862911 5:116660882-116660904 CCAAGAGTGCAGAAATGCCCAGG - Intergenic
1001407890 5:171488782-171488804 CCAAGGTGGCAGAAGTGACCAGG + Intergenic
1001808647 5:174610145-174610167 CCAAGAGGGCAGATGTGGGCAGG + Intergenic
1002603907 5:180370770-180370792 TCATGAGGACAGAAGAGAACAGG + Intergenic
1002868636 6:1146329-1146351 CCACGAGGGCAGAAGAGAACGGG + Intergenic
1002895262 6:1375858-1375880 CCATGAAGGCATAAGTGCCTTGG - Intergenic
1003513703 6:6801939-6801961 GCATGAGGGAAGAAGGGATCAGG + Intergenic
1004734345 6:18390084-18390106 TCATAAGGTCAGAAGTGACTTGG + Intronic
1005812520 6:29528403-29528425 CCAAGAGGGCAGAGGTTACCTGG - Intergenic
1006582503 6:35084969-35084991 CCCTGAGGGCGGCAGAGACCTGG - Intronic
1006814849 6:36843163-36843185 TCATGAGGGCAGAGGTGAGACGG + Intergenic
1007048207 6:38798858-38798880 CCACTAGGGCTGAAGGGACCAGG + Intronic
1009790478 6:68395074-68395096 TCATGAAGGCAAAAGTGACTGGG + Intergenic
1011628066 6:89299391-89299413 CCATGAAGGCAGAGGTGCCCAGG - Intronic
1016105227 6:140153881-140153903 CCATGAAAGGAGAAGTGAGCTGG + Intergenic
1016831741 6:148440939-148440961 CCATGAGAGCAGAAATTACAGGG - Intronic
1018275521 6:162126298-162126320 TCATGAGTTCAGAAATGACCAGG - Intronic
1018452556 6:163922649-163922671 TCATGAAGGCAAAAGTGCCCAGG + Intergenic
1019273012 7:161080-161102 CCCTGAGGGCAGATGAGACCAGG - Intergenic
1019849909 7:3544474-3544496 CCAAGAGAGCAGAAGTGACTGGG - Intronic
1021198465 7:17698713-17698735 CCCTGAGAGCAGAAGAGACGAGG + Intergenic
1022553954 7:31272683-31272705 TCAGGAGGGGAGAAGTGACCTGG - Intergenic
1024271230 7:47643424-47643446 TCACGAGGTCAGAAGTGATCGGG - Intergenic
1026025608 7:66741293-66741315 CCTAGGGGGCAGAAGTGTCCCGG + Intronic
1026409778 7:70108049-70108071 CCATGAGGACAGAACTGAACTGG - Intronic
1030856058 7:114559142-114559164 GCATGAGGGCAGCAGTCAACAGG - Intronic
1032386933 7:131531654-131531676 CCATGAGGGCAGAGGTTGGCGGG - Intronic
1032411536 7:131696977-131696999 TCATGAGAGCAAAAGTGAGCTGG + Intergenic
1032813483 7:135446993-135447015 TCAGGAGGGCAGAAATGACCCGG + Intronic
1034125458 7:148667649-148667671 CCATGTGCGGAGAAGGGACCTGG + Intergenic
1034127972 7:148691001-148691023 CCATGAGGGCATAAGAGTCTGGG + Intergenic
1034436447 7:151064812-151064834 CCACATGGGCAGGAGTGACCAGG - Intronic
1035523501 8:293618-293640 CCATGAAGGCAGCGGTGTCCAGG - Intergenic
1035727437 8:1833673-1833695 GCATGAGGGCAGCAGCGGCCTGG - Intronic
1036712830 8:11092890-11092912 CCATGAGGGCCAAGGAGACCTGG + Intronic
1037149674 8:15621076-15621098 TAATGAGGGCAGAAGAGAACTGG - Intronic
1037516280 8:19635153-19635175 CCATCAGGGCAGAGGGGACCAGG + Intronic
1038145409 8:24890140-24890162 CCATTTGGGCAGAATGGACCTGG + Intergenic
1038844615 8:31217088-31217110 CCATGAGGGAAGAAGAGATTGGG + Intergenic
1041839783 8:62255776-62255798 CCATGAGGGCAGCACTGTCCAGG - Intronic
1042193832 8:66214835-66214857 CAGTTAGGGAAGAAGTGACCTGG + Intergenic
1043775250 8:84259154-84259176 GCCAGAGGGCAGAAGTGACAAGG + Intronic
1044383928 8:91565108-91565130 GCAAGATGGCAGAAGTGACCGGG - Intergenic
1045115949 8:98979855-98979877 CCATGAGGGCAGAACTCATATGG + Intergenic
1046344920 8:112910862-112910884 CCAAGAGGCCACCAGTGACCTGG - Intronic
1049409669 8:142466847-142466869 CTCTGAGGGGTGAAGTGACCAGG - Intronic
1049571484 8:143372117-143372139 CCAGGAGGGGAGCAGGGACCTGG + Intronic
1050633730 9:7587215-7587237 AAATGAGGGCAGGAGTGAACAGG - Intergenic
1050812178 9:9762106-9762128 CCTTGAGGGCAGGACTGTCCTGG - Intronic
1051032171 9:12694236-12694258 CCATGATGGCAGAGATGATCGGG + Exonic
1056199240 9:84258479-84258501 CCCGCAGGGCAGATGTGACCCGG - Intergenic
1056733745 9:89186537-89186559 CAATGAGGCCAGGAGAGACCAGG + Intergenic
1056745580 9:89298869-89298891 CAATGAGGGAAGAAGGAACCAGG + Intergenic
1057333913 9:94141523-94141545 CCAGGAGGGCAGATGTCACCGGG - Intergenic
1058941497 9:109816798-109816820 CCATGAGGGCAGAGGAGTCATGG + Intronic
1061168853 9:128940506-128940528 CCAAGTGGGCAGAAGAGACAGGG - Intronic
1061379677 9:130246899-130246921 TCATGAGGGCAGAACTGTCATGG - Intergenic
1062071870 9:134560074-134560096 CCATGGGGTCAGATGTGCCCAGG + Intergenic
1062234513 9:135501419-135501441 CCAGGCGGGCCCAAGTGACCTGG + Intronic
1062235782 9:135506933-135506955 TCAGGTGGGCAGAAGTGACAAGG + Intergenic
1185847086 X:3447736-3447758 CCAAGATGGCAGAAGGGACACGG + Intergenic
1188618900 X:32195017-32195039 GCAAGAGGGCAGAGGTGACCTGG + Intronic
1189658098 X:43267861-43267883 CAATGAGGGCCGAAGTGCTCTGG - Intergenic
1189884208 X:45523696-45523718 CCATGAAGGCAGAAGTATCCAGG + Intergenic
1190232310 X:48591691-48591713 CCTGGAGGTCAGAAGAGACCAGG + Intronic
1190982636 X:55469866-55469888 CCATTAGTGCAGCAGTGAACAGG - Intergenic
1190986063 X:55503317-55503339 CCATTAGTGCAGCAGTGAACAGG + Intergenic
1192161979 X:68795153-68795175 AACTGAGGGCAGAAGTGACAGGG + Intergenic
1192212839 X:69138670-69138692 CCTTGAGGGCAGCAGAGATCTGG - Intergenic
1194653695 X:96546060-96546082 CCATGAAGGCAAAAGTGGCTGGG + Intergenic
1195704883 X:107731747-107731769 CCATGGGGGCAGACATGATCTGG - Intronic
1196418927 X:115503387-115503409 TCATGAGAGCTTAAGTGACCTGG - Intergenic
1196661744 X:118277935-118277957 CCATAAAGGCATAAGTGACCAGG - Intergenic
1198394346 X:136207230-136207252 CCCTGAGGGCAGACGTGATGTGG + Intronic
1198427907 X:136538227-136538249 CCATGAAGACAAAAGTGTCCAGG - Intronic
1201324447 Y:12740528-12740550 ACAAGAAGTCAGAAGTGACCTGG + Intronic