ID: 1153002591

View in Genome Browser
Species Human (GRCh38)
Location 18:469457-469479
Sequence ACTACCTATCCATAATGTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 67}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153002591_1153002592 4 Left 1153002591 18:469457-469479 CCAACACATTATGGATAGGTAGT 0: 1
1: 0
2: 0
3: 6
4: 67
Right 1153002592 18:469484-469506 GTCACATCACTTTGATATGCAGG 0: 1
1: 0
2: 2
3: 7
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153002591 Original CRISPR ACTACCTATCCATAATGTGT TGG (reversed) Intronic
905659813 1:39712824-39712846 GCTACTCATCCATAATATGTTGG + Intronic
907606003 1:55818137-55818159 ATTACCTATCCCCATTGTGTGGG + Intergenic
909794537 1:79717396-79717418 ACTACCTATCACTAATGAGAAGG + Intergenic
911460913 1:98189199-98189221 ACCACCTTTCCATAATATTTTGG - Intergenic
921360948 1:214330712-214330734 ACTCCTTATCTAAAATGTGTTGG - Intronic
1068068163 10:52159927-52159949 AATACCTTTTCATAATGTTTTGG + Intronic
1068162892 10:53289400-53289422 GCTCCCTATCTATGATGTGTAGG - Intergenic
1069001849 10:63276159-63276181 ACTGCCTATCTCTAATGTCTTGG - Intronic
1071005085 10:80875035-80875057 GATACATATCCAGAATGTGTAGG + Intergenic
1082055151 11:47808529-47808551 TCCACCTACCCATAATGTATAGG - Exonic
1092698762 12:11203422-11203444 AGTGCCTATCCATAAAGTTTTGG - Intergenic
1098134036 12:67382717-67382739 ACTACCCATAGAGAATGTGTGGG - Intergenic
1099459836 12:82908767-82908789 ACTAGCTAGGCATAATGTTTTGG + Intronic
1101284000 12:103290691-103290713 CTTACCTTTCTATAATGTGTGGG - Intronic
1102237204 12:111301123-111301145 TATACGTCTCCATAATGTGTGGG - Intronic
1116279004 14:42877335-42877357 AATACCTATTCATCATTTGTAGG - Intergenic
1117045188 14:51806369-51806391 ACTCTCTATCCAGAGTGTGTGGG - Intergenic
1117566571 14:56999820-56999842 TTTACCTATCTATAATGTGGGGG + Intergenic
1118366099 14:65097586-65097608 ACTACCTTTACAAAATGTGAAGG + Intronic
1123820234 15:24022381-24022403 ATTACCTGTCCAAACTGTGTGGG + Intergenic
1136006296 16:27331891-27331913 AATAACAATCCTTAATGTGTAGG - Intronic
1146608795 17:34286499-34286521 ACTAAATATCTATAATGTATGGG + Intronic
1146934264 17:36801769-36801791 ACTTCCTATTCCTTATGTGTGGG - Intergenic
1148035951 17:44659860-44659882 ACTACCTTTCCAGAATTTGTTGG - Intronic
1153002591 18:469457-469479 ACTACCTATCCATAATGTGTTGG - Intronic
1157017208 18:43730422-43730444 CCTACTTATCCATGATGTATTGG + Intergenic
1166588945 19:43978235-43978257 ACCACCTTTCCATAATGGGTAGG - Intronic
926377412 2:12246972-12246994 ACTACCTGCTCATAATATGTAGG + Intergenic
928504627 2:31938030-31938052 ACTACCTTACCTTGATGTGTAGG - Intronic
931284843 2:60823381-60823403 ACTACCTGGCCATAATGGGAAGG - Intergenic
943272925 2:185830193-185830215 ACTACCTATATAAAATGTGTAGG + Intronic
1169287188 20:4319367-4319389 ACTACATGTCCATCATGGGTGGG + Intergenic
1171454329 20:25258966-25258988 ACTAACTTTCCATGATGTGTGGG - Intronic
1175520059 20:59596910-59596932 ACTACCTCTCCATGCTGTGATGG + Intronic
949272801 3:2239470-2239492 ACTGCTGATCCATAATGTGATGG - Intronic
951682732 3:25311373-25311395 ACTAGCCATCCATACTGTTTGGG + Intronic
953078376 3:39592606-39592628 ACTCCCTCTCCATAAAATGTGGG + Intergenic
964794954 3:160486940-160486962 ACTAACCATCAATAATGTGCTGG - Intergenic
965155278 3:165044221-165044243 AACCCCTATCCAAAATGTGTGGG - Intronic
970103372 4:12551766-12551788 ACTATCTATCTATAATCAGTGGG - Intergenic
973933323 4:55816199-55816221 ACTACATATCCAAGATATGTGGG - Intergenic
974318487 4:60312595-60312617 ACTACCTATACTCAATGTGGAGG + Intergenic
976655105 4:87480367-87480389 CTTACCTATCCATAGGGTGTTGG + Exonic
977453976 4:97234735-97234757 ACCACTAATCCAAAATGTGTGGG - Intronic
986580971 5:9265334-9265356 CCTGCCTATCCATGAGGTGTGGG + Intronic
987851913 5:23365509-23365531 ACTACCTTTTCATAATTTTTTGG - Intergenic
993973403 5:94447197-94447219 ACTACAGATCCATAATATATGGG - Intronic
994577029 5:101590971-101590993 ACTTAATATCCATAATGTCTAGG + Intergenic
997197023 5:131987185-131987207 ACTCCCTGTCTGTAATGTGTGGG - Intronic
1004702044 6:18088360-18088382 AATGCCTATTCATAATCTGTGGG - Intergenic
1004860024 6:19794234-19794256 GCTACATATCCATGATGGGTTGG - Intergenic
1008155665 6:48010967-48010989 AATGCCTATCCATAATAGGTTGG - Intronic
1010387355 6:75296831-75296853 ATTAATTATCCATAATGTGCTGG - Intronic
1014813888 6:125914142-125914164 AGTAACTATCCATACAGTGTAGG - Intronic
1017277621 6:152588590-152588612 CCTTCCTATCCATAATGTAGGGG - Intronic
1018200229 6:161387738-161387760 TCCACCTATCCATTATGTGGGGG - Intronic
1023653432 7:42394498-42394520 ACTACTTATTCAGAATGTGATGG - Intergenic
1026730892 7:72910934-72910956 TCTACCTTTCCAGAATTTGTTGG + Intronic
1027113195 7:75457235-75457257 TCTACCTTTCCAGAATTTGTTGG - Intronic
1027285445 7:76641830-76641852 TCTACCTTTCCAGAATTTGTTGG - Intergenic
1030226793 7:107161676-107161698 ATTAGCTATTCATCATGTGTGGG + Exonic
1041646921 8:60262540-60262562 AATCCTTTTCCATAATGTGTGGG - Intronic
1044195366 8:89370720-89370742 ACTTCCTATCCAAAATGCTTCGG + Intergenic
1044500777 8:92952949-92952971 ACTACATATCCAAAATAAGTTGG - Intronic
1045685864 8:104711556-104711578 AATGCCTATCAATAATGTGATGG + Intronic
1047255421 8:123210024-123210046 ACTACATATCCATTGTGGGTTGG - Intronic
1047480788 8:125281011-125281033 CCTGCCTATCCAGAATGGGTCGG + Intronic
1047778723 8:128094612-128094634 AATACCTACCCATCGTGTGTGGG + Intergenic
1048251383 8:132869365-132869387 ACTCCCTATCCATACAATGTGGG + Intronic
1049188325 8:141271145-141271167 ATTTCCTAGCCATAATGTGTGGG - Intronic
1052276481 9:26682306-26682328 ACTACCAATTCATCATGTGTGGG - Intergenic
1059772410 9:117439962-117439984 ACTACATATTCATGATTTGTAGG - Intergenic
1190413058 X:50156146-50156168 ACTAGCTATCCCTATGGTGTCGG + Intergenic
1193513910 X:82439663-82439685 ACAACCTAGCCATCATCTGTTGG - Intergenic