ID: 1153005284

View in Genome Browser
Species Human (GRCh38)
Location 18:492879-492901
Sequence ATTTCAGTGTGGGAGGTGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153005284_1153005289 4 Left 1153005284 18:492879-492901 CCTCTCACCTCCCACACTGAAAT No data
Right 1153005289 18:492906-492928 CACTTAAGAGATTTCAGGTCAGG No data
1153005284_1153005290 9 Left 1153005284 18:492879-492901 CCTCTCACCTCCCACACTGAAAT No data
Right 1153005290 18:492911-492933 AAGAGATTTCAGGTCAGGCACGG No data
1153005284_1153005291 12 Left 1153005284 18:492879-492901 CCTCTCACCTCCCACACTGAAAT No data
Right 1153005291 18:492914-492936 AGATTTCAGGTCAGGCACGGTGG No data
1153005284_1153005288 -1 Left 1153005284 18:492879-492901 CCTCTCACCTCCCACACTGAAAT No data
Right 1153005288 18:492901-492923 TGTCACACTTAAGAGATTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153005284 Original CRISPR ATTTCAGTGTGGGAGGTGAG AGG (reversed) Intronic