ID: 1153005286

View in Genome Browser
Species Human (GRCh38)
Location 18:492889-492911
Sequence TAAGTGTGACATTTCAGTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153005286_1153005289 -6 Left 1153005286 18:492889-492911 CCCACACTGAAATGTCACACTTA No data
Right 1153005289 18:492906-492928 CACTTAAGAGATTTCAGGTCAGG No data
1153005286_1153005291 2 Left 1153005286 18:492889-492911 CCCACACTGAAATGTCACACTTA No data
Right 1153005291 18:492914-492936 AGATTTCAGGTCAGGCACGGTGG No data
1153005286_1153005292 29 Left 1153005286 18:492889-492911 CCCACACTGAAATGTCACACTTA No data
Right 1153005292 18:492941-492963 TGCCTGTAATCCCAGCACTTTGG No data
1153005286_1153005290 -1 Left 1153005286 18:492889-492911 CCCACACTGAAATGTCACACTTA No data
Right 1153005290 18:492911-492933 AAGAGATTTCAGGTCAGGCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153005286 Original CRISPR TAAGTGTGACATTTCAGTGT GGG (reversed) Intronic