ID: 1153005287

View in Genome Browser
Species Human (GRCh38)
Location 18:492890-492912
Sequence TTAAGTGTGACATTTCAGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153005287_1153005292 28 Left 1153005287 18:492890-492912 CCACACTGAAATGTCACACTTAA No data
Right 1153005292 18:492941-492963 TGCCTGTAATCCCAGCACTTTGG No data
1153005287_1153005290 -2 Left 1153005287 18:492890-492912 CCACACTGAAATGTCACACTTAA No data
Right 1153005290 18:492911-492933 AAGAGATTTCAGGTCAGGCACGG No data
1153005287_1153005289 -7 Left 1153005287 18:492890-492912 CCACACTGAAATGTCACACTTAA No data
Right 1153005289 18:492906-492928 CACTTAAGAGATTTCAGGTCAGG No data
1153005287_1153005291 1 Left 1153005287 18:492890-492912 CCACACTGAAATGTCACACTTAA No data
Right 1153005291 18:492914-492936 AGATTTCAGGTCAGGCACGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153005287 Original CRISPR TTAAGTGTGACATTTCAGTG TGG (reversed) Intronic