ID: 1153005287 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 18:492890-492912 |
Sequence | TTAAGTGTGACATTTCAGTG TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 4 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1153005287_1153005292 | 28 | Left | 1153005287 | 18:492890-492912 | CCACACTGAAATGTCACACTTAA | No data | ||
Right | 1153005292 | 18:492941-492963 | TGCCTGTAATCCCAGCACTTTGG | No data | ||||
1153005287_1153005290 | -2 | Left | 1153005287 | 18:492890-492912 | CCACACTGAAATGTCACACTTAA | No data | ||
Right | 1153005290 | 18:492911-492933 | AAGAGATTTCAGGTCAGGCACGG | No data | ||||
1153005287_1153005289 | -7 | Left | 1153005287 | 18:492890-492912 | CCACACTGAAATGTCACACTTAA | No data | ||
Right | 1153005289 | 18:492906-492928 | CACTTAAGAGATTTCAGGTCAGG | No data | ||||
1153005287_1153005291 | 1 | Left | 1153005287 | 18:492890-492912 | CCACACTGAAATGTCACACTTAA | No data | ||
Right | 1153005291 | 18:492914-492936 | AGATTTCAGGTCAGGCACGGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1153005287 | Original CRISPR | TTAAGTGTGACATTTCAGTG TGG (reversed) | Intronic | ||