ID: 1153005289

View in Genome Browser
Species Human (GRCh38)
Location 18:492906-492928
Sequence CACTTAAGAGATTTCAGGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153005286_1153005289 -6 Left 1153005286 18:492889-492911 CCCACACTGAAATGTCACACTTA No data
Right 1153005289 18:492906-492928 CACTTAAGAGATTTCAGGTCAGG No data
1153005284_1153005289 4 Left 1153005284 18:492879-492901 CCTCTCACCTCCCACACTGAAAT No data
Right 1153005289 18:492906-492928 CACTTAAGAGATTTCAGGTCAGG No data
1153005285_1153005289 -3 Left 1153005285 18:492886-492908 CCTCCCACACTGAAATGTCACAC No data
Right 1153005289 18:492906-492928 CACTTAAGAGATTTCAGGTCAGG No data
1153005287_1153005289 -7 Left 1153005287 18:492890-492912 CCACACTGAAATGTCACACTTAA No data
Right 1153005289 18:492906-492928 CACTTAAGAGATTTCAGGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153005289 Original CRISPR CACTTAAGAGATTTCAGGTC AGG Intronic