ID: 1153005616

View in Genome Browser
Species Human (GRCh38)
Location 18:496444-496466
Sequence CCCTTCACTGATTGGTAATA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 83}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153005616 Original CRISPR CCCTTCACTGATTGGTAATA GGG (reversed) Intronic
912065457 1:105734859-105734881 ACCTCCACTGATTTGCAATATGG - Intergenic
919490468 1:198199010-198199032 TCCATCACTGGTTGGTAATGAGG - Intronic
920576494 1:207064694-207064716 CCCTATTCTGAGTGGTAATAGGG + Intronic
921284769 1:213599506-213599528 CCCCCCACTGTTTGGAAATATGG - Intergenic
921453571 1:215339901-215339923 CTCTTCTCTGATTGGATATAGGG - Intergenic
922084739 1:222335499-222335521 ACCTTCACTGCTTAATAATATGG + Intergenic
922628448 1:227078032-227078054 ACCTTCACTTATTTGTAAGATGG - Intronic
922947890 1:229532252-229532274 CATTTCACTGATTTCTAATAAGG + Intronic
923538087 1:234868497-234868519 CCCTTCACAGATGGGGAATCTGG + Intergenic
1063288163 10:4712614-4712636 CCCTTCAAAGATTCGTAAGAGGG - Intergenic
1064289500 10:14020805-14020827 CCCTTGAATGATTGGGAATTTGG - Intronic
1064893928 10:20212053-20212075 CCTTTCTCTCCTTGGTAATATGG - Intronic
1065412983 10:25450733-25450755 CCCTTCTTTGACTGGTAATAGGG + Intronic
1069205507 10:65679154-65679176 TCCTTCAATGATTGTTAATATGG + Intergenic
1069757355 10:70781548-70781570 CCTTTCTCTGATTTGTAAAATGG + Intronic
1070532956 10:77353311-77353333 CCCATCACTGAGTGGTTGTAGGG + Intronic
1077709141 11:4518312-4518334 CCCTTCCCTGAATTCTAATATGG + Intergenic
1085191638 11:74630719-74630741 TCTTTTACTGATTGGAAATAGGG - Intronic
1085540777 11:77267838-77267860 CCCATCTCTGCTTGGTAAAATGG + Intronic
1092227007 12:6753846-6753868 CCCTTCACAGATGGGTAACGGGG - Intronic
1094455215 12:30624436-30624458 AACTTCACTCATTGGAAATATGG + Intergenic
1097174519 12:57135162-57135184 CCAGCCACTGATTGGAAATACGG - Intronic
1101481932 12:105106975-105106997 CTCTTCAGTGATTCGTAGTATGG + Intergenic
1109758862 13:66799669-66799691 TCAATCACTGATTTGTAATAAGG + Intronic
1111729064 13:92050390-92050412 GCTTTCACTGAGTGGTTATATGG + Intronic
1113704707 13:112420555-112420577 CCCATAACTCTTTGGTAATATGG - Intronic
1120288416 14:82535120-82535142 CCCTTGAATGATAGGTGATAAGG - Intergenic
1120294157 14:82618960-82618982 TTCTTCCCAGATTGGTAATAAGG - Intergenic
1122445551 14:101765219-101765241 CCCTTCACTGCTTCCTCATAAGG + Intronic
1124470187 15:29977263-29977285 TTCTTCACTCATTGGTAGTAAGG - Intergenic
1134201635 16:12204227-12204249 CCCTGGACTTTTTGGTAATAGGG + Intronic
1136744124 16:32568406-32568428 CCCTTCACAGATTCTTAAAAAGG - Intergenic
1203025475 16_KI270728v1_random:506827-506849 CCCTTCACAGATTCTTAAAAAGG + Intergenic
1203046246 16_KI270728v1_random:827604-827626 CCCTTCACAGATTCTTAAAAAGG - Intergenic
1149711990 17:58751747-58751769 ATCTTGACTGATTGGTCATATGG - Intergenic
1150507267 17:65712081-65712103 CCCTTCCCTGCTTGGTCAGAGGG + Intronic
1152045698 17:77933941-77933963 CCCTTTTCTGAGTCGTAATAAGG - Intergenic
1153005616 18:496444-496466 CCCTTCACTGATTGGTAATAGGG - Intronic
1159621616 18:70645286-70645308 CCCTTCCCTGACTGGTGAGAAGG + Intronic
930902856 2:56529088-56529110 CCCTTCATTTATAGATAATAAGG - Intergenic
939861301 2:147423723-147423745 CCCTTCACTCAATAGTGATAAGG - Intergenic
940476906 2:154174187-154174209 CCCTTCACTGATTGGCTGGATGG + Intronic
948179752 2:235970430-235970452 CCCCTCCCTGATTGGGAAGAAGG + Intronic
1171037068 20:21722891-21722913 CCCTTCACAGATGACTAATAGGG - Intergenic
1172763061 20:37335767-37335789 CACTTCTCTCATTGGTAAAACGG - Intergenic
1175343020 20:58246896-58246918 CCCTCCAGTGTTTGCTAATATGG - Intergenic
1178687105 21:34720629-34720651 CCCTTCACACATTGGTATTTTGG + Intergenic
950162352 3:10769989-10770011 CCTTTCCCTGATTGGTAATGAGG - Intergenic
950742820 3:15063758-15063780 CCCTTCACTGTTTGGCATTGTGG - Intronic
950825577 3:15816396-15816418 CTTTTCCCTGATTTGTAATATGG + Intronic
951328801 3:21340046-21340068 TCCTTCACTCATTGGTCATTTGG - Intergenic
952845020 3:37681052-37681074 CTCTTCACGGATGGGTAATGAGG + Intronic
957747913 3:84368623-84368645 CCATTCACTGACTTGCAATATGG - Intergenic
962422660 3:135241841-135241863 TCCTTCACTGATAGGTGATATGG - Intronic
968322527 3:197783034-197783056 CCTTTCACTGATTTCTTATATGG + Exonic
968861984 4:3179558-3179580 CCCTTCACTGAGGGGTCAGAGGG + Intronic
969510235 4:7613470-7613492 CCATTCACTGAGGTGTAATAAGG + Intronic
973983363 4:56325674-56325696 CCTTCAAGTGATTGGTAATAAGG - Intronic
976736417 4:88314394-88314416 CACTTCATTGATTGTTAATGAGG - Intergenic
976980080 4:91216793-91216815 CCTTTCACTCATTGGTAAAATGG - Intronic
988725543 5:33922825-33922847 CCCATCAGTGATTGCTTATAAGG + Intergenic
996133770 5:119813843-119813865 CCCTTCCCTGATGGATAATTTGG + Intergenic
997421133 5:133767596-133767618 CCCTTGACTCATTTGTACTATGG - Intergenic
999060076 5:148624383-148624405 CCCTTCATAGAGTGGTCATATGG + Intronic
1001528171 5:172443894-172443916 CCTATCACTGACTGGTAATAAGG - Intronic
1003586528 6:7394550-7394572 TCCTTCACTGATTCATAATGAGG + Intronic
1006916188 6:37595237-37595259 CCCTTCACTGACTCTTAATCAGG - Intergenic
1008486774 6:52044890-52044912 CTCCTCACTGATTTGTAACATGG - Intronic
1010896715 6:81374009-81374031 TCCTTCATTGATTGTTTATATGG + Intergenic
1011390758 6:86850253-86850275 ACCTTCACAGATTGGTTATGGGG - Intergenic
1014630852 6:123788309-123788331 TCCTTCACCGATTGGTCACAAGG + Intergenic
1015605389 6:134950158-134950180 ACATTCACTGATTGGTAAAGGGG - Intergenic
1022316024 7:29246421-29246443 CCCTTCACTCCTTGGAAACAAGG - Intronic
1022769945 7:33459086-33459108 CTCTTCAGTAATTGGCAATAAGG - Intronic
1022892207 7:34713086-34713108 CCCTTCTGTGATTGTTAAGAAGG + Intronic
1028246091 7:88478908-88478930 ACCATCAATGACTGGTAATAGGG + Intergenic
1030683802 7:112462140-112462162 CACTTCATTGATTGGGCATATGG - Exonic
1033804889 7:144942472-144942494 AACTTCACTGACTGGTAATAGGG + Intergenic
1036806542 8:11838272-11838294 CCCTTTCCTCATTGGTAAAATGG + Intronic
1040618976 8:49068086-49068108 CCCTTCTTTGCCTGGTAATAAGG - Intronic
1046011875 8:108558498-108558520 CATTTCTCTGATTGCTAATAAGG + Intergenic
1047115626 8:121838830-121838852 ACCTCCACAGATTGGTTATAAGG - Intergenic
1048725052 8:137374033-137374055 CCTTTCCCTGTTTTGTAATATGG - Intergenic
1050729026 9:8686560-8686582 CCCTTCACTTATTTCTAAAATGG - Intronic
1055769021 9:79696369-79696391 CGCTTAACTGATTGGTCTTAAGG - Intronic
1058186760 9:101864226-101864248 CCATTCAGTGATTGGTAACCAGG + Intergenic
1059993469 9:119887061-119887083 CCCTGCACTGAATGGTACCAGGG - Intergenic
1185979400 X:4759931-4759953 GCCTTCACTGACTGGTAAATTGG - Intergenic
1195340940 X:103905302-103905324 CCCTTCAGTGAATGGGGATAAGG + Intergenic
1195726837 X:107926378-107926400 ACCTTGACTTATTGGTATTATGG - Intronic
1196323921 X:114378728-114378750 CCCTTCAAATTTTGGTAATATGG - Intergenic