ID: 1153007142

View in Genome Browser
Species Human (GRCh38)
Location 18:507052-507074
Sequence ACATTTTGCTACTGTTGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153007142_1153007145 -6 Left 1153007142 18:507052-507074 CCTGGGCAACAGTAGCAAAATGT No data
Right 1153007145 18:507069-507091 AAATGTATGGGACATCCCTTTGG No data
1153007142_1153007148 20 Left 1153007142 18:507052-507074 CCTGGGCAACAGTAGCAAAATGT No data
Right 1153007148 18:507095-507117 TTTTTTTGTGACTGACTGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153007142 Original CRISPR ACATTTTGCTACTGTTGCCC AGG (reversed) Intergenic
No off target data available for this crispr