ID: 1153007805

View in Genome Browser
Species Human (GRCh38)
Location 18:512993-513015
Sequence CTTGAGAGGGAGACCGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153007800_1153007805 -8 Left 1153007800 18:512978-513000 CCAGCTTCCGCTCGGCTTGAGAG No data
Right 1153007805 18:512993-513015 CTTGAGAGGGAGACCGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153007805 Original CRISPR CTTGAGAGGGAGACCGTGGA AGG Intergenic
No off target data available for this crispr