ID: 1153014188

View in Genome Browser
Species Human (GRCh38)
Location 18:568622-568644
Sequence TTTCTGTTCTGGGGCATCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153014188_1153014197 -2 Left 1153014188 18:568622-568644 CCTGAGATGCCCCAGAACAGAAA No data
Right 1153014197 18:568643-568665 AATTGAGAGGCTTGGGGCATGGG No data
1153014188_1153014200 19 Left 1153014188 18:568622-568644 CCTGAGATGCCCCAGAACAGAAA No data
Right 1153014200 18:568664-568686 GGCCAAGGTGAGGTACTAACAGG No data
1153014188_1153014198 4 Left 1153014188 18:568622-568644 CCTGAGATGCCCCAGAACAGAAA No data
Right 1153014198 18:568649-568671 GAGGCTTGGGGCATGGGCCAAGG No data
1153014188_1153014196 -3 Left 1153014188 18:568622-568644 CCTGAGATGCCCCAGAACAGAAA No data
Right 1153014196 18:568642-568664 AAATTGAGAGGCTTGGGGCATGG No data
1153014188_1153014199 9 Left 1153014188 18:568622-568644 CCTGAGATGCCCCAGAACAGAAA No data
Right 1153014199 18:568654-568676 TTGGGGCATGGGCCAAGGTGAGG No data
1153014188_1153014194 -9 Left 1153014188 18:568622-568644 CCTGAGATGCCCCAGAACAGAAA No data
Right 1153014194 18:568636-568658 GAACAGAAATTGAGAGGCTTGGG No data
1153014188_1153014195 -8 Left 1153014188 18:568622-568644 CCTGAGATGCCCCAGAACAGAAA No data
Right 1153014195 18:568637-568659 AACAGAAATTGAGAGGCTTGGGG No data
1153014188_1153014193 -10 Left 1153014188 18:568622-568644 CCTGAGATGCCCCAGAACAGAAA No data
Right 1153014193 18:568635-568657 AGAACAGAAATTGAGAGGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153014188 Original CRISPR TTTCTGTTCTGGGGCATCTC AGG (reversed) Intergenic
No off target data available for this crispr