ID: 1153014756

View in Genome Browser
Species Human (GRCh38)
Location 18:573546-573568
Sequence GCCAAATGGGCTGCCTGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153014756_1153014760 7 Left 1153014756 18:573546-573568 CCTTCACAGGCAGCCCATTTGGC No data
Right 1153014760 18:573576-573598 GTGTTACCTAACACCACTGTGGG No data
1153014756_1153014759 6 Left 1153014756 18:573546-573568 CCTTCACAGGCAGCCCATTTGGC No data
Right 1153014759 18:573575-573597 TGTGTTACCTAACACCACTGTGG No data
1153014756_1153014763 29 Left 1153014756 18:573546-573568 CCTTCACAGGCAGCCCATTTGGC No data
Right 1153014763 18:573598-573620 GCTTCTGACCTTTCAACCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153014756 Original CRISPR GCCAAATGGGCTGCCTGTGA AGG (reversed) Intergenic
No off target data available for this crispr