ID: 1153015728

View in Genome Browser
Species Human (GRCh38)
Location 18:580816-580838
Sequence CCTGCAGCTCCTCATCCGTG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 244
Summary {0: 1, 1: 0, 2: 4, 3: 32, 4: 207}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153015728_1153015737 28 Complete closest: None
total_pairs: 1
max_distance: 1000
Left 1153015728 18:580816-580838 CCTCACGGATGAGGAGCTGCAGG 0: 1
1: 0
2: 4
3: 32
4: 207
Right 1153015737 18:580867-580889 GGACGGCGAAGTGAACGAGGAGG 0: 1
1: 0
2: 0
3: 3
4: 88
1153015728_1153015733 6 Complete closest: None
total_pairs: 1
max_distance: 1000
Left 1153015728 18:580816-580838 CCTCACGGATGAGGAGCTGCAGG 0: 1
1: 0
2: 4
3: 32
4: 207
Right 1153015733 18:580845-580867 TCGACGAAGCTGATCGGGATGGG 0: 1
1: 0
2: 0
3: 0
4: 17
1153015728_1153015736 25 Complete closest: None
total_pairs: 1
max_distance: 1000
Left 1153015728 18:580816-580838 CCTCACGGATGAGGAGCTGCAGG 0: 1
1: 0
2: 4
3: 32
4: 207
Right 1153015736 18:580864-580886 TGGGGACGGCGAAGTGAACGAGG 0: 1
1: 0
2: 1
3: 2
4: 75
1153015728_1153015730 0 Complete closest: None
total_pairs: 1
max_distance: 1000
Left 1153015728 18:580816-580838 CCTCACGGATGAGGAGCTGCAGG 0: 1
1: 0
2: 4
3: 32
4: 207
Right 1153015730 18:580839-580861 AGATGATCGACGAAGCTGATCGG 0: 1
1: 0
2: 0
3: 1
4: 24
1153015728_1153015732 5 Complete closest: 611
total_pairs: 2
max_distance: 1000
Left 1153015728 18:580816-580838 CCTCACGGATGAGGAGCTGCAGG 0: 1
1: 0
2: 4
3: 32
4: 207
Right 1153015732 18:580844-580866 ATCGACGAAGCTGATCGGGATGG 0: 1
1: 0
2: 0
3: 1
4: 17
1153015728_1153015731 1 Complete closest: None
total_pairs: 1
max_distance: 1000
Left 1153015728 18:580816-580838 CCTCACGGATGAGGAGCTGCAGG 0: 1
1: 0
2: 4
3: 32
4: 207
Right 1153015731 18:580840-580862 GATGATCGACGAAGCTGATCGGG 0: 1
1: 0
2: 0
3: 3
4: 18
1153015728_1153015735 11 Complete closest: 617
total_pairs: 2
max_distance: 1000
Left 1153015728 18:580816-580838 CCTCACGGATGAGGAGCTGCAGG 0: 1
1: 0
2: 4
3: 32
4: 207
Right 1153015735 18:580850-580872 GAAGCTGATCGGGATGGGGACGG 0: 1
1: 0
2: 1
3: 81
4: 355
1153015728_1153015734 7 Complete closest: None
total_pairs: 1
max_distance: 1000
Left 1153015728 18:580816-580838 CCTCACGGATGAGGAGCTGCAGG 0: 1
1: 0
2: 4
3: 32
4: 207
Right 1153015734 18:580846-580868 CGACGAAGCTGATCGGGATGGGG 0: 1
1: 0
2: 0
3: 1
4: 30

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153015728 Original CRISPR CCTGCAGCTCCTCATCCGTG AGG (reversed) Exonic
900237371 1:1599207-1599229 CCGGCAGGTCCTCCTCCGCGGGG + Exonic
900385484 1:2408697-2408719 CCTGCAGCTCCTGCTCCAGGGGG + Exonic
902197156 1:14806168-14806190 CCTGAAGCTCCTCAAGGGTGTGG + Intronic
903063852 1:20687519-20687541 CCTGCGGCTCCTCTTGCGGGAGG + Exonic
908688715 1:66752878-66752900 CCTGGAGGTCCTCATGGGTGCGG - Intronic
914950486 1:152109685-152109707 GCTGCAGCTCCTCTTCCTCGCGG + Exonic
917570783 1:176263186-176263208 CCTGCATCTCCACATCCTTGAGG - Intergenic
918097298 1:181345884-181345906 CCTGCAGCCCCTCCTTCCTGTGG - Intergenic
920171259 1:204073643-204073665 GCTCCTGCTCCTCCTCCGTGCGG - Exonic
920398120 1:205661031-205661053 CCTGCATCTCCTCCTCCCTTGGG + Intronic
923454449 1:234151106-234151128 CCAGCAGCCCCTCCTCAGTGTGG - Intronic
924068839 1:240254826-240254848 CCTGCATCTCCACATCCCCGGGG - Intronic
924774509 1:247106467-247106489 CCTGAAGCTCCTCCTCAGTGTGG - Intergenic
924897915 1:248362288-248362310 CCTCATGCTCCTCATCCCTGTGG + Exonic
1063352720 10:5371628-5371650 TCTGCAGCTCCTCATCAGTGTGG - Intronic
1063360200 10:5447871-5447893 CCTGCAGCTTATCATCTGTTGGG + Intronic
1063371428 10:5525214-5525236 CCCGCAGCTCGGCCTCCGTGGGG - Exonic
1063951393 10:11226479-11226501 CCTGCAGCTCGTCATAGATGTGG + Intronic
1064803963 10:19109683-19109705 ACTGCATCTCCCCATCCATGAGG - Intronic
1065975812 10:30841475-30841497 CATGCAGCACCTCATTCCTGCGG - Intronic
1067478347 10:46580261-46580283 CAGGCAGCTCCTCATAGGTGAGG - Exonic
1067616391 10:47761526-47761548 CAGGCAGCTCCTCATAGGTGAGG + Intergenic
1069247922 10:66230950-66230972 CCTGCACCTCCATATCCCTGGGG - Intronic
1070805503 10:79268399-79268421 CCAGCAGCTCCCCATTCCTGGGG - Intronic
1071598312 10:86943598-86943620 ACTGCAACTCCTCCTCCCTGCGG + Exonic
1073006931 10:100331376-100331398 CCTGCAGTTTCTCCTCCTTGAGG + Intergenic
1073705056 10:105973674-105973696 CCTGGAGCCCCTCCTCCTTGCGG - Intergenic
1074673327 10:115820673-115820695 CCTTCAGATCCTCATCTGAGAGG + Intronic
1076564631 10:131389741-131389763 CCTGCAGCCCCTGATCAGTGTGG + Intergenic
1076743117 10:132497933-132497955 CCTGCAGCGTCTCATGCTTGGGG - Intergenic
1077541855 11:3150417-3150439 CCAGCAGCTCCTCCTCCTTAGGG + Intronic
1078087566 11:8243289-8243311 CCTGAACCTCCTCAGCCATGCGG - Intronic
1078098279 11:8313585-8313607 CCTGCAGCTGCTCTTCCGTGTGG - Intergenic
1078428637 11:11270574-11270596 CCTGCAGCCCTTCATTCCTGAGG - Intergenic
1083365776 11:62140755-62140777 GCTGCAGCTCCTCATCCTCCAGG - Exonic
1083430971 11:62613311-62613333 CCTGCAGCCCCGCATCCGCCTGG + Exonic
1084082855 11:66840357-66840379 ACTGCAGAACCTCATCAGTGTGG + Intronic
1084287403 11:68141119-68141141 CCTCCTGCTCCTCATGCGTGTGG - Intergenic
1084319509 11:68365656-68365678 CCTGCAGCTGCACACCCGTGGGG - Exonic
1084463338 11:69308319-69308341 CCTGCAGCTGCTCATACTTTTGG + Intronic
1084548348 11:69825704-69825726 GCTGCAGCCCCTCATCTCTGGGG + Intergenic
1084641996 11:70431724-70431746 CTTGCAGCCCCTCATGAGTGTGG + Intronic
1085076671 11:73597917-73597939 CCTGCAGCTGCTCACCGGTGAGG - Exonic
1085406684 11:76267354-76267376 TCTCCAGCTCCTCTTCCTTGTGG + Intergenic
1086836588 11:91631833-91631855 CCTGCTTCTGCTCATCCTTGTGG - Intergenic
1087016359 11:93557984-93558006 CCTGCACCTGCCCATCCTTGGGG - Intergenic
1088135671 11:106552768-106552790 CCTGCACTTCCTCTTCCCTGAGG + Intergenic
1091067645 11:132531084-132531106 CCTCCAGCTCCTCATCCTCTAGG - Intronic
1091901365 12:4146690-4146712 CCTCCATCTCCTCATCTGTATGG + Intergenic
1092365050 12:7871047-7871069 CCTGCAGGTATTCATCCATGGGG - Intronic
1096123127 12:49101495-49101517 CCTGGAGCTGCTCATCGATGAGG - Exonic
1096575809 12:52552223-52552245 CCTGCTGCTCCTGATCCGCTGGG + Intronic
1096660990 12:53123892-53123914 CATCCAGCTCCCCATCCATGAGG + Intronic
1104857398 12:131908541-131908563 CCTGGCGCTCTCCATCCGTGTGG + Intronic
1105699789 13:22927075-22927097 TCCGCAGCTCGTCCTCCGTGCGG - Intergenic
1107751464 13:43571774-43571796 CCTCCAATTCCTCATCTGTGAGG + Intronic
1108718589 13:53106582-53106604 CTTGCAGATACCCATCCGTGCGG + Intergenic
1109808190 13:67471275-67471297 CCTGCATCTTCACATCCCTGGGG - Intergenic
1111160130 13:84384079-84384101 CCTGCATCTCCACATCCCTAAGG + Intergenic
1111572429 13:90105120-90105142 CCTGCAGCTCCACATTCCTGGGG - Intergenic
1112058146 13:95710136-95710158 CGTGCAGCTGCTCATCTGTTAGG + Intronic
1112537631 13:100275376-100275398 CCTGCTGCTCCCCAGCCGTGGGG + Intronic
1112815083 13:103263820-103263842 CCGGCATCTCCACATCCCTGGGG - Intergenic
1113205022 13:107907283-107907305 CCTGCAGCTCCCCAGCCGAGAGG + Intergenic
1113642366 13:111967070-111967092 CCTGCAGCTCCCCAGCCCTCAGG + Intergenic
1118596835 14:67442226-67442248 TCTGCAGCACCCCATCCTTGAGG + Intergenic
1121011912 14:90524707-90524729 CCTGCAGCTGCCCAGCCCTGGGG + Exonic
1121030573 14:90654954-90654976 CCTGCAGCTCAGCAGCTGTGGGG + Intronic
1121080918 14:91107800-91107822 CCGCCAGCTCCTCATCCCTCTGG - Intronic
1121559922 14:94866882-94866904 CCTGCTCCTCCTCATCAGTAGGG - Intergenic
1128728977 15:70007770-70007792 CCTGCATTTCATCATCCCTGTGG - Intergenic
1129608958 15:77038202-77038224 CCTGCAGCAGCTCATCAGTGTGG - Intergenic
1129907295 15:79197422-79197444 CCTGCTGCTCCTCTTCCATGAGG - Intergenic
1131065562 15:89433095-89433117 CCTGCACTTGCTCATCCATGGGG + Intergenic
1132543014 16:520154-520176 CCTGCAGCTCCTCAAGCTGGAGG + Exonic
1132544699 16:527857-527879 CCTCCCGCTCCTCAGCCGCGGGG - Exonic
1135237844 16:20775167-20775189 CCTGCATCTCCACATCCCTGGGG - Intronic
1136429514 16:30188414-30188436 CCAGCCACTCCTCAGCCGTGAGG - Exonic
1136927484 16:34388515-34388537 CCTGCAGTTCCTCAGCAGAGAGG - Intergenic
1136977090 16:35023291-35023313 CCTGCAGTTCCTCAGCAGAGAGG + Exonic
1137913737 16:52405605-52405627 CCTGGATCTCCTCATGCCTGTGG + Intergenic
1138182365 16:54950161-54950183 TCTGCAGCTCATCCTCGGTGGGG - Intergenic
1138450613 16:57091935-57091957 CCTGGGTCTACTCATCCGTGCGG - Intergenic
1140054623 16:71515282-71515304 CCTGCTGTTCCTCATTCCTGAGG - Intronic
1142790647 17:2262132-2262154 ACTGCAGCTCCTGATGCGTATGG - Intronic
1143019373 17:3908833-3908855 CCTGCTGCTCCCCAGCTGTGTGG + Intronic
1143811823 17:9477973-9477995 CCTGCATTTCCACACCCGTGTGG - Intronic
1144943664 17:18959001-18959023 CCCTGGGCTCCTCATCCGTGAGG + Intronic
1146689797 17:34865473-34865495 CCTGCGGCTCCTCCACCCTGGGG + Intergenic
1148847709 17:50538901-50538923 GCTGCAGGTCCTCGTCCCTGTGG - Exonic
1149531689 17:57400742-57400764 CCTGCAGGTCCTTCTCCTTGGGG - Intronic
1149650373 17:58272733-58272755 CCTGCAGCCCCTCACCTGGGAGG + Exonic
1150221217 17:63496918-63496940 CATGCAGCTCGTTCTCCGTGCGG - Exonic
1151530095 17:74698568-74698590 CCTGCAGCTCATCAGGTGTGTGG - Intronic
1151657711 17:75503410-75503432 CCTGCAGCTCCTCCCAGGTGAGG + Exonic
1152315557 17:79578409-79578431 CCTGCACATCCTCTTCTGTGTGG + Intergenic
1152531333 17:80921199-80921221 CCTTCAGGTCCGCATCCGCGTGG - Intronic
1152615506 17:81336095-81336117 CCTGCTGCTTCTCATGGGTGGGG - Intergenic
1152689412 17:81711293-81711315 GCTGCAGGTCTTCATCCCTGTGG + Intergenic
1152720785 17:81923003-81923025 TCACCAGCTCCTCATCCGTCAGG + Exonic
1153015728 18:580816-580838 CCTGCAGCTCCTCATCCGTGAGG - Exonic
1153171931 18:2326735-2326757 TCTCCAGCTCCTCATCCAGGGGG + Intergenic
1155101021 18:22609856-22609878 CCTGCTGCCTCTCATCCGTCAGG - Intergenic
1155159348 18:23183088-23183110 CCTGCGTCCCCTCATCAGTGTGG + Intronic
1155960619 18:31991821-31991843 CCTGCTGCACCTCTCCCGTGGGG + Intergenic
1156391910 18:36659003-36659025 CCAGCAGCTCCTCATTCATCAGG + Intronic
1156793874 18:41015720-41015742 CCTGCATCTCCACATCCCTGAGG + Intergenic
1159156427 18:64589188-64589210 CCTGCAGCTGGTTATCTGTGTGG + Intergenic
1159931422 18:74316135-74316157 CCTGCTCCTCCGCAACCGTGGGG - Intronic
1160225773 18:77009667-77009689 CCTGCAGCTGCTTTTCCCTGGGG + Intronic
1161355814 19:3819151-3819173 CCAGGAGCTCCTGCTCCGTGGGG + Exonic
1162091061 19:8280464-8280486 CCTGCAGCCCCCCATGCCTGAGG - Intronic
1162093295 19:8295302-8295324 CCTGCAGCCCCCCATGCCTGAGG - Intronic
1163013533 19:14440308-14440330 CCTCCAGCTCCTGCTCCGAGGGG - Exonic
1163478468 19:17540326-17540348 CCTGCACATCCCCATCTGTGAGG + Intronic
1163819720 19:19489258-19489280 CCTGCAGCTCCACAGCCCTGGGG + Intronic
1165140773 19:33698759-33698781 CCTGTAGCTCCTCCACCGAGGGG + Intronic
1165162659 19:33826916-33826938 GCAACAGCTCCTCATGCGTGGGG + Intergenic
1165337575 19:35182548-35182570 CCTGCATCTCCACATCCCTGGGG + Intergenic
1166258975 19:41625110-41625132 CCTGAAGCTTCTCATCAGTGAGG - Intronic
1166976546 19:46608291-46608313 CCTGCAGCTCTGCTTCAGTGGGG - Exonic
1167503789 19:49861148-49861170 CCTGGAGCCCCTCCCCCGTGGGG + Intergenic
1167568622 19:50272696-50272718 CCTGCAGCTCCTCCTCCTTCCGG - Exonic
1168354219 19:55691895-55691917 CCTCCAGCTGCTGATCCCTGGGG + Exonic
924964183 2:60084-60106 CCTGCAATTCCTTATCCCTGGGG + Intergenic
925115707 2:1376634-1376656 CCTGCCCTGCCTCATCCGTGTGG - Intronic
926430093 2:12776812-12776834 CCTGCAGCAACACATCCTTGGGG + Intergenic
926776827 2:16431339-16431361 CCTGCAGCCCCTGATCTGTCAGG - Intergenic
934646221 2:96060647-96060669 CCTCCAGCTCCTGCACCGTGAGG + Intergenic
935703606 2:105836770-105836792 CCAGCATCTCCACATCCCTGGGG - Intronic
936753493 2:115675867-115675889 CCTGCATTTCCACATCCCTGGGG + Intronic
942246418 2:174012920-174012942 TCTGCCGCTCCTCCGCCGTGGGG + Intergenic
944703938 2:202269835-202269857 CCTTCAGCTGCTCTTCCATGTGG + Intronic
946228833 2:218279314-218279336 CGTGCAGCTGCTCATCACTGTGG - Exonic
948775378 2:240285508-240285530 CCTGAAGCTGCTCTTCCCTGGGG - Intergenic
948921512 2:241068054-241068076 CCTGCCGCTCCTCACCTGAGCGG + Intronic
1170118993 20:12892159-12892181 CCTGCTGCTCCCCACCCTTGAGG - Intergenic
1170774538 20:19364178-19364200 CCTGCAGATCACCAACCGTGTGG + Intronic
1171349377 20:24491001-24491023 CCTGGAGCTCCTCGTGCGTCTGG + Intronic
1173469437 20:43311316-43311338 AATGGAGCCCCTCATCCGTGGGG + Intergenic
1173868697 20:46328821-46328843 CCTGAACCTCCTCTTCCTTGAGG - Intergenic
1175191631 20:57215668-57215690 CAGGCAGCTGCCCATCCGTGTGG - Intronic
1175223806 20:57433297-57433319 TCTGCAGCTCCACAGCCATGTGG + Intergenic
1179794615 21:43775884-43775906 CCAGAAGCGCCTCATCCCTGGGG + Intronic
1181805877 22:25374192-25374214 CCTGCAGCTGCACACCCATGGGG + Intronic
1182101897 22:27663269-27663291 CCTGCCGCTCCTCATTCCTCAGG + Intergenic
1182764150 22:32746488-32746510 CTAGCACCTCCTCATCCCTGTGG - Intronic
1183316004 22:37137245-37137267 CCATCTGCTCCACATCCGTGCGG - Intronic
1184436429 22:44480832-44480854 CCAGCAGCTCCTAATAAGTGAGG - Intergenic
1184694904 22:46133738-46133760 CCTGCACCTCCCCAGCCCTGTGG + Intergenic
1184874484 22:47264830-47264852 TCTGCAGCTCCTCACTAGTGTGG - Intergenic
1185066619 22:48635474-48635496 GCAGCAGCTCCTCCTCCGTGAGG + Intronic
1185294737 22:50047522-50047544 CCTGCAGCCCCACATCGGGGTGG - Intronic
950136026 3:10581486-10581508 TCTGCAGTTCCTCATCACTGTGG - Intronic
950891979 3:16412390-16412412 CCTTCAGCTCTTCCTCTGTGAGG - Intronic
951241805 3:20295040-20295062 CCTGCATCTCCACATACCTGAGG - Intergenic
953912179 3:46898788-46898810 CGCGCAGCTCCTCCTCGGTGAGG - Exonic
954106998 3:48414849-48414871 CCTGCAGCCACTCAACCCTGAGG - Exonic
954701275 3:52452133-52452155 CCTGCAGCTCCTCAGGGGTGGGG + Exonic
955668892 3:61381212-61381234 CCTGCATCTCCAAATCCTTGGGG - Intergenic
956160548 3:66346869-66346891 CCTGCTGCTCCCCATCCAAGTGG - Intronic
956467990 3:69537361-69537383 TCTGCAGCTCTTCAGCCTTGAGG - Intronic
958606411 3:96364192-96364214 CCTGTATCTCCACATCCCTGAGG + Intergenic
961474172 3:127136516-127136538 CCTGCAGCTCCTCTGCCATGAGG - Intergenic
964358444 3:155870913-155870935 CCTGCAGCACCGCATCCCGGCGG + Intronic
967889911 3:194357649-194357671 CCTGGAGCTCCTCCTGCGTGTGG - Intronic
968492606 4:898292-898314 CCTGCAGCACCTCACACCTGCGG + Intronic
968646685 4:1744601-1744623 GCTGCAGCTTCTCCTCCGCGTGG - Exonic
968919699 4:3516124-3516146 CCTCCAGCTCCTTGTCCGTGAGG + Exonic
969723535 4:8906371-8906393 CCTGCAGCTCCTCAGACAGGTGG + Intergenic
970609093 4:17709119-17709141 CCTGCAGCTCCTCGGCCTTGCGG + Exonic
970831186 4:20341519-20341541 CCTGCTGCTCCTGGTTCGTGTGG - Intronic
971927618 4:33034022-33034044 CCTGCATCTCCACACCCCTGAGG + Intergenic
980834077 4:138168711-138168733 ACTGTAGCTCCTCAGCCCTGTGG - Exonic
984185543 4:176538664-176538686 CCTGGAGCTCCTCATTGGTCTGG - Intergenic
985171831 4:187158226-187158248 TCTGCAGCTCCTCAACGGTGTGG + Intergenic
985650463 5:1105073-1105095 ACTGCAGGACCTCATCCCTGCGG - Intronic
985650479 5:1105122-1105144 ACTGCAGGACCTCATCCCTGCGG - Intronic
985650492 5:1105170-1105192 ACTGCAGGACCTCATCCCTGCGG - Intronic
985650508 5:1105219-1105241 ACTGCAGGACCTCATCCCTGCGG - Intronic
985650537 5:1105316-1105338 ACTGCAGGACCTCATCCCTGCGG - Intronic
985650566 5:1105413-1105435 ACTGCAGGACCTCATCCCTGTGG - Intronic
985878633 5:2620071-2620093 CCTGCAGCTTCTCAGGCTTGGGG + Intergenic
986208444 5:5647988-5648010 CCTGCTGCGCCTCATCGGCGAGG - Intergenic
990376109 5:55172940-55172962 ACAGCATCTCCTCTTCCGTGCGG + Exonic
991240868 5:64458677-64458699 CCTGCAACTCCACATCCCTGGGG + Intergenic
997590282 5:135068052-135068074 CCTGCTGCTGTTCATCCTTGAGG + Intronic
998132556 5:139658731-139658753 CCTGCAGCTCCCCCTCCCTTGGG + Intronic
998607158 5:143647196-143647218 CATGCAGCGGCTCATCCCTGAGG - Intergenic
999745615 5:154589723-154589745 TCTGCTGCTCCTCATCAGCGAGG + Intergenic
1000416390 5:160988266-160988288 CCTGGAGCTTGTCATCCCTGGGG + Intergenic
1000418085 5:161005371-161005393 CCTGCATCTCCACATCCCTGGGG - Intergenic
1000833050 5:166127465-166127487 CCTGCATCTGCACATCCTTGGGG + Intergenic
1001953267 5:175830748-175830770 CCTCCAGATCCTCACCCCTGTGG + Intronic
1002680764 5:180961732-180961754 CCTGCATCTCCACATCCCTGGGG - Intergenic
1006917632 6:37605159-37605181 CCTGCAGCCCCTCATCATGGTGG + Intergenic
1012025572 6:93986052-93986074 CCTGCATCTCCACATCCCTGGGG + Intergenic
1013491017 6:110646441-110646463 CATGCACCGCCTCATCCCTGAGG + Intronic
1018360043 6:163058260-163058282 CCTGCAGCTCTTTGTCCGTCAGG + Intronic
1019180091 6:170181276-170181298 CCTCCAGCTCCTCTTCCCAGCGG + Intergenic
1022113283 7:27244101-27244123 CCTGCAGCTCCTTTTCCTTTGGG - Intronic
1024132140 7:46363990-46364012 CATGCAGCTCATCATGCCTGGGG + Intergenic
1026739927 7:72972757-72972779 CCTGCAGCTCCGCACCCCCGGGG + Intergenic
1027103806 7:75392313-75392335 CCTGCAGCTCCGCACCCCCGGGG - Intergenic
1029167805 7:98606777-98606799 CCTGTAGCTCCTCTTTGGTGAGG + Intergenic
1033141132 7:138827524-138827546 TCTTGAACTCCTCATCCGTGAGG - Intronic
1033681709 7:143601527-143601549 CCTGCATCACCTCATCCCAGAGG - Intergenic
1033703182 7:143860286-143860308 CCTGCATCACCTCATCCCAGAGG + Exonic
1035327735 7:158075780-158075802 CCTGCTGCTCCGCAGCCATGAGG - Intronic
1035642898 8:1197494-1197516 CCAGCTGCTCCGCATCCATGTGG - Intergenic
1038116978 8:24567795-24567817 CCTGCAGCTTCTCATTGCTGAGG - Intergenic
1038336531 8:26650195-26650217 CCTCCACCTCCTCATCTGTGAGG - Intronic
1038679433 8:29653164-29653186 CTTGGAGCTCCTCATCAGTAAGG - Intergenic
1039406355 8:37316015-37316037 CCTGCAGCTCCTCTTTGCTGGGG + Intergenic
1041972567 8:63760627-63760649 CCTTCAGCTCCTGATCAGTTTGG + Intergenic
1045402733 8:101834947-101834969 TCTGCAGCTCCCTATCTGTGTGG + Intronic
1045544814 8:103119035-103119057 TCTGCAGCCCTTAATCCGTGAGG + Intergenic
1048063865 8:130948455-130948477 ACTGCATCACCTCATCCCTGTGG - Intronic
1048920851 8:139228747-139228769 CCTGCTGCTCATCAGCTGTGTGG - Intergenic
1049266421 8:141670280-141670302 CCTGCTCTTCCTCATCCCTGTGG + Intergenic
1050731997 9:8719506-8719528 CCTGCAACTCCTCATCAGACAGG - Intronic
1053055203 9:34989815-34989837 CCCGCAGCTCCTCACCGGTGAGG + Exonic
1053409874 9:37909073-37909095 CCTGCAGCTCACCATCCATCTGG - Intronic
1056676406 9:88680294-88680316 GCTTCAGTTCCCCATCCGTGTGG + Intergenic
1057390776 9:94639921-94639943 TCTGCAGCTCCTGCCCCGTGTGG + Intronic
1058111066 9:101030715-101030737 CCTGCTGCTCCTCACGGGTGGGG + Intronic
1060952426 9:127612557-127612579 CCTGAGGCTCCTGGTCCGTGGGG + Intronic
1061627489 9:131849632-131849654 GCTGCAGCTCCTCATCCGAGAGG + Intergenic
1062324219 9:136004665-136004687 CCTTCATCTCCTCATCAGAGTGG + Intergenic
1062515209 9:136930257-136930279 CCCGCTGCTCCACATCCTTGTGG + Intronic
1062568836 9:137175236-137175258 CCAGCAGCTCCTCCTCCTTCTGG + Exonic
1062693293 9:137856817-137856839 CCTGCATCTCCACATCCATGAGG - Intronic
1186729311 X:12391728-12391750 CCAGAAGCTCCTCAACCCTGAGG - Intronic
1187213855 X:17255391-17255413 CCTGCACCTTCTCATCCTGGAGG - Intergenic
1187273435 X:17799120-17799142 CCTCCAGTTCCTCATTTGTGTGG + Intergenic
1189307433 X:39997448-39997470 CCTCCAGCTCCTCTTCATTGCGG + Intergenic
1189458397 X:41215409-41215431 CCTGCAGCTCCTGAGACCTGAGG + Intronic
1190776742 X:53558753-53558775 CTTCCAGCTCCTCATCCCTCAGG + Exonic
1195278091 X:103301999-103302021 CCAGCAGCTTCTCAGCTGTGTGG + Intergenic
1199136132 X:144255219-144255241 CCTGCATCTCCACATCCTTGGGG + Intergenic
1199966953 X:152828536-152828558 CCTGCAGCTCCTCATCAGTCAGG + Exonic
1200691173 Y:6307099-6307121 CCTGCAGCTCATGAACCCTGAGG + Intergenic
1201044099 Y:9867617-9867639 CCTGCAGCTCATGAACCCTGAGG - Intergenic
1202115355 Y:21466108-21466130 CCTGCAGCTCATGAACCCTGAGG - Intergenic