ID: 1153018597

View in Genome Browser
Species Human (GRCh38)
Location 18:606550-606572
Sequence GCTTCTCCTGACCAGGGGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 271
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 248}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153018597_1153018605 27 Left 1153018597 18:606550-606572 CCTCACCCCTGGTCAGGAGAAGC 0: 1
1: 0
2: 2
3: 20
4: 248
Right 1153018605 18:606600-606622 CAAGCCTGGCTTTCTCACCCAGG 0: 1
1: 0
2: 2
3: 75
4: 1204
1153018597_1153018602 13 Left 1153018597 18:606550-606572 CCTCACCCCTGGTCAGGAGAAGC 0: 1
1: 0
2: 2
3: 20
4: 248
Right 1153018602 18:606586-606608 AGCTTCCCAGTAATCAAGCCTGG 0: 1
1: 0
2: 0
3: 7
4: 123
1153018597_1153018606 28 Left 1153018597 18:606550-606572 CCTCACCCCTGGTCAGGAGAAGC 0: 1
1: 0
2: 2
3: 20
4: 248
Right 1153018606 18:606601-606623 AAGCCTGGCTTTCTCACCCAGGG 0: 1
1: 0
2: 4
3: 41
4: 458

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153018597 Original CRISPR GCTTCTCCTGACCAGGGGTG AGG (reversed) Intronic
901138634 1:7013697-7013719 GCTTGTCCACACCAGGGGGGCGG - Intronic
903049102 1:20587688-20587710 TCTCCTGCTGGCCAGGGGTGTGG + Intergenic
903131721 1:21283964-21283986 ACTTCTCCTGCCCCAGGGTGAGG - Intronic
903188027 1:21640256-21640278 GCTTCTCCTGGTCTGGGGAGGGG - Intronic
903359550 1:22768212-22768234 TCTGCTCCTGACCAGCTGTGTGG + Intronic
904345160 1:29863101-29863123 TCTTCTGCTGAGTAGGGGTGGGG + Intergenic
905183035 1:36178247-36178269 GCTTCTCCTGTGTGGGGGTGTGG + Intronic
905635644 1:39549782-39549804 GCTTTTCCAGACCAGGTGAGTGG - Intergenic
906287677 1:44598238-44598260 GCTGCTCATGACCTGGGGAGGGG - Intronic
907745769 1:57212225-57212247 GCTTCTCCTCACTGGGGGTCTGG - Intronic
909720761 1:78767239-78767261 GCTTCCCTTGTCTAGGGGTGGGG - Intergenic
915247975 1:154569447-154569469 CTTTCCCCTGCCCAGGGGTGTGG + Exonic
915554478 1:156653800-156653822 GTTTCTCCTCATCAGGAGTGAGG - Intronic
920496504 1:206458703-206458725 ACTCCTCCTCCCCAGGGGTGGGG + Exonic
922572698 1:226643281-226643303 CCTTCTCCAGAGCAGAGGTGGGG + Intronic
923763604 1:236871182-236871204 GATTTAACTGACCAGGGGTGGGG - Intronic
924510609 1:244726653-244726675 GCTTCTCTTAACTAGGGGTTTGG + Intergenic
1062892813 10:1077265-1077287 CCTTCGCCTTCCCAGGGGTGCGG + Intronic
1067061887 10:43081894-43081916 CCTTCTCCTGACCAAGGCTCTGG + Intronic
1067304963 10:45055061-45055083 GCTTCACCTTATGAGGGGTGCGG - Intergenic
1067352382 10:45488135-45488157 GCATCTCCTCACCTGTGGTGTGG - Intronic
1067712293 10:48658786-48658808 GCCCCACCTGACCAGGGCTGAGG - Intergenic
1067944718 10:50682628-50682650 GTTTCAGCTGGCCAGGGGTGGGG - Intergenic
1069750795 10:70743969-70743991 TCTTCTCCTGACCAGGGCCTGGG + Intronic
1069867832 10:71514571-71514593 GCTTCTCCTGAGCTGGGGGCTGG - Intronic
1072854196 10:98929321-98929343 GCTTTCCTTGACCAGGGTTGTGG + Intronic
1075541353 10:123316996-123317018 GCTTCTTCAGAGCAGGGTTGAGG - Intergenic
1077380808 11:2236472-2236494 GCGTCCCCTGACCTGGGGTGTGG + Intergenic
1079093860 11:17498481-17498503 GGTTCTCCTGAGCTGGGGTGAGG - Intronic
1079102665 11:17551563-17551585 TGTTCCCCTGACCTGGGGTGAGG + Intronic
1081268454 11:41056929-41056951 GCCTCTACTGAGTAGGGGTGGGG - Intronic
1082833094 11:57633929-57633951 GACTCTCCTGAGAAGGGGTGGGG + Intergenic
1083197678 11:61098880-61098902 GCCTCTCCAGCCCAGGGATGGGG + Intergenic
1083613963 11:64017531-64017553 CCTTTCCCTGGCCAGGGGTGGGG + Intronic
1083685409 11:64372093-64372115 GCTACTCCTGGCTGGGGGTGGGG + Exonic
1083758082 11:64802022-64802044 GCTTCTGGAGACCAGAGGTGTGG + Intronic
1083815062 11:65128062-65128084 CCTTCTCCTGGAAAGGGGTGGGG + Exonic
1083815474 11:65130277-65130299 GCCTCTCCTGAGCTGGGGGGAGG + Exonic
1084146249 11:67266802-67266824 GCTTCTCCTCACCTGGGCTCGGG - Exonic
1084562153 11:69911184-69911206 GCTTCTGCTGGCCAGGGGGAAGG - Intergenic
1085459162 11:76682788-76682810 TCTTCTGCAGAACAGGGGTGAGG - Intergenic
1085623907 11:78057553-78057575 GCTTCTGTTGCCCAGTGGTGTGG - Intronic
1086092966 11:83022133-83022155 GCTTCTTCTTATTAGGGGTGGGG + Intronic
1088391594 11:109320656-109320678 GCTTCTCCTGGACAGGGGTTGGG - Intergenic
1089202266 11:116731667-116731689 GCTTCCCCTGGCCAGGGGAGCGG + Intergenic
1089590922 11:119540328-119540350 GCCTATCCTGACCAGGGGCCAGG + Intergenic
1091565803 12:1647046-1647068 GCTTCCCCTCCCCGGGGGTGGGG - Exonic
1091899742 12:4135119-4135141 GGCCCTCCTGGCCAGGGGTGGGG - Intergenic
1092217950 12:6695494-6695516 GCTCCTCATGGTCAGGGGTGGGG + Exonic
1092778397 12:11963869-11963891 GGTGCTCCTGAGCAGGGGTTGGG + Intergenic
1096609289 12:52790342-52790364 GCTGCTGCTGACCACGGCTGTGG + Exonic
1098828556 12:75330378-75330400 GCTTCTCCTGAGCAGGGAAAGGG + Intronic
1102558179 12:113742580-113742602 GCTGCTGCTGCCCAGGGGTGAGG - Intergenic
1103448070 12:121007814-121007836 GCTTTTCCTGAACAGGGCTTGGG - Intronic
1103482500 12:121260153-121260175 GCTGATCCCAACCAGGGGTGTGG + Intronic
1103517852 12:121518956-121518978 GCTCCTCCAGACCAGGGTGGGGG + Intronic
1103692164 12:122784065-122784087 GATTCGTGTGACCAGGGGTGAGG - Intronic
1104047727 12:125174758-125174780 CCTTCTCTTGACCAGAGGGGTGG + Intergenic
1108716317 13:53081539-53081561 ACTTCTGCTGTCCAGGTGTGAGG + Intergenic
1117674103 14:58138590-58138612 GCTTCTCCTTATCAGGGGTGAGG + Exonic
1119087827 14:71753468-71753490 TCTCCTCCTCCCCAGGGGTGGGG - Intergenic
1120109811 14:80540688-80540710 CCTTCTCCTGGTTAGGGGTGAGG - Intronic
1121016997 14:90555001-90555023 CCTTCTCCTGACCTGGAGTGAGG - Intronic
1121782342 14:96629995-96630017 GCTGCTCTTGAACAGGAGTGAGG + Intergenic
1123011123 14:105350098-105350120 GCCTGTCCTGCCCATGGGTGTGG + Intronic
1123135677 14:106025604-106025626 GCTTCTTCTTAGGAGGGGTGTGG + Intergenic
1123171583 14:106377756-106377778 GCTTCTCCAGAGGAGGGGTGTGG + Intergenic
1123583308 15:21735968-21735990 GCTTCTTCTGAGGAGGGATGTGG + Intergenic
1123619958 15:22178565-22178587 GCTTCTTCTGAGGAGGGATGTGG + Intergenic
1123945780 15:25238242-25238264 GCTTCGCTTCCCCAGGGGTGGGG + Intergenic
1124396699 15:29308525-29308547 GCCTCCCCTTACCAGCGGTGCGG + Intronic
1125767819 15:42146922-42146944 GCTCCTCCTCCCCAGGGGTTAGG + Intronic
1128378564 15:67094376-67094398 GCTCCTCCTGAGCAGGGCTGAGG + Intronic
1129075783 15:72994870-72994892 ACTTTTTCTGCCCAGGGGTGGGG - Intergenic
1129436353 15:75544243-75544265 GCAGCTCCTGGCCAGGCGTGGGG + Intronic
1129941172 15:79497738-79497760 CATTCTCCTGTCCCGGGGTGGGG + Intergenic
1131139422 15:89965025-89965047 GCTTCGTGTGACCTGGGGTGGGG + Intergenic
1131158648 15:90090402-90090424 GCCTCTCCAGACTTGGGGTGGGG - Intronic
1132375279 15:101324633-101324655 ACTTCTCCTGGCCAGGTCTGTGG + Intronic
1132550420 16:551743-551765 CCTCCTGCTGACCTGGGGTGGGG + Intronic
1132598137 16:762468-762490 GCTCCTCCTGTCCAGGGGAGGGG - Intronic
1132700363 16:1219680-1219702 GCTGCTGATGTCCAGGGGTGGGG + Intronic
1133001524 16:2853825-2853847 GGCCCTCCTGGCCAGGGGTGGGG + Intronic
1133118140 16:3589840-3589862 GCTTCTGCTGGCCAGCGGGGTGG + Exonic
1133968161 16:10546708-10546730 GATTGTCATAACCAGGGGTGGGG + Intronic
1136246480 16:28979166-28979188 GCTCCTCCTGACCCGGGGCCTGG + Exonic
1136622235 16:31436841-31436863 GCTTCTCATGAGCAGGGCTTCGG + Exonic
1136852479 16:33623773-33623795 TCTGCTCCTGGGCAGGGGTGTGG + Intergenic
1138998020 16:62476928-62476950 GCCTCTCCTGCCCAGGGAAGTGG - Intergenic
1141477255 16:84282173-84282195 TCTTGCCCTGACCTGGGGTGTGG + Intergenic
1141610730 16:85179817-85179839 GCTTCTGATGCCCAGGGTTGTGG - Intronic
1141908226 16:87041554-87041576 GCTGCTGCTTGCCAGGGGTGTGG - Intergenic
1203114079 16_KI270728v1_random:1472241-1472263 TCTGCTCCTGGGCAGGGGTGTGG + Intergenic
1143368991 17:6426750-6426772 GCTTCTCCTGCCCAGGGAGAAGG + Exonic
1144090793 17:11854380-11854402 GCTTCTCCTGGGCAGCTGTGAGG - Exonic
1144654240 17:17025241-17025263 GATGCCCCTGGCCAGGGGTGTGG - Intergenic
1145277139 17:21438951-21438973 GCTTCTACACACCTGGGGTGTGG - Intergenic
1145314976 17:21724845-21724867 GCTTCTACACACCTGGGGTGTGG - Intergenic
1145761159 17:27426081-27426103 GCTTCCCCAGCCCAGGGGTCCGG + Intergenic
1145846324 17:28041956-28041978 GCTTCTGCTGAGGAGGGTTGGGG - Intronic
1145978168 17:28996318-28996340 GCTTCTCCTGCCCCAGGGTGTGG + Intronic
1146346419 17:32063037-32063059 GCTCCTCCGGACTAGTGGTGCGG - Intergenic
1147140517 17:38458278-38458300 GCTTCCCCAGACCAGGGCAGCGG - Intronic
1149982498 17:61322405-61322427 GCTGGTCCTCACCAAGGGTGAGG - Intronic
1150658180 17:67054165-67054187 GCTTCTTCTCATCAGGCGTGAGG - Intronic
1151420253 17:73992471-73992493 CCTTCTCCTGGCCAGGGGTGTGG - Intergenic
1152817283 17:82415513-82415535 GCTGCTCCAGAGCAGGAGTGCGG + Exonic
1152931505 17:83112367-83112389 GCTTTTCCTGTCCTGGGCTGGGG + Intergenic
1153018597 18:606550-606572 GCTTCTCCTGACCAGGGGTGAGG - Intronic
1156507554 18:37607937-37607959 GATTCTCCTAGCCATGGGTGTGG - Intergenic
1157572226 18:48720811-48720833 GCTTGTTCTGCCCAGGAGTGCGG - Intronic
1157672982 18:49546084-49546106 GCTTTGCCTGGCCAGGGTTGTGG + Intergenic
1160006596 18:75073169-75073191 GCTTCTCCTGGGCATGGGTGGGG - Intergenic
1160466722 18:79083639-79083661 GCTTCCCTTGGCTAGGGGTGGGG + Intronic
1162786176 19:13036378-13036400 TCCTCTCCAGGCCAGGGGTGGGG + Intronic
1163676519 19:18658093-18658115 GCTGCTGGTGGCCAGGGGTGGGG + Intronic
1163822200 19:19502425-19502447 GGTCCTGCTGACCAGGGCTGTGG - Exonic
1166192512 19:41184380-41184402 GCATCTCCTGGCCCAGGGTGGGG + Intergenic
1166636798 19:44458082-44458104 GCAGCTCCTCACCAGGGATGTGG - Intergenic
1166702527 19:44890661-44890683 GCTACTCCGAACCAGAGGTGGGG + Intronic
1166800175 19:45451610-45451632 GCTTCATGTGACCAGGGCTGGGG + Intronic
1167862674 19:52297735-52297757 GCTTCTCCTAACCCTGCGTGTGG + Intronic
1167874270 19:52398387-52398409 GGTTCTCCTGACCCCGAGTGTGG + Exonic
1202648876 1_KI270706v1_random:163105-163127 GCAGCTCCTCACCAGGGATGTGG - Intergenic
925263919 2:2551247-2551269 GCTTCTTCTGTCAAGGGATGTGG - Intergenic
925477318 2:4231956-4231978 AGTTCTCCTGCCCAGGGGTGAGG + Intergenic
929617045 2:43319387-43319409 GCTACTCCTATCCAGGGATGTGG + Intronic
938540783 2:132282086-132282108 GCAGCTCCTCACCAGGGATGTGG - Intergenic
938541610 2:132287989-132288011 GCAGCTCCTCACCAGGGATGTGG - Intergenic
938574841 2:132594182-132594204 ACTCCTCATAACCAGGGGTGGGG + Intronic
938696120 2:133837082-133837104 GGTGCTCCTGTCCAGGGGTGGGG + Intergenic
944480602 2:200153834-200153856 GATTCTCCGGTCCTGGGGTGAGG + Intergenic
944667979 2:201972632-201972654 GCAGCTCCTTGCCAGGGGTGTGG + Intergenic
945703766 2:213203590-213203612 GATTCTCCTGACCAAAGGAGAGG - Intergenic
946934914 2:224709979-224710001 GCTTCTCCTGAGCATGTTTGTGG - Intergenic
948320646 2:237066013-237066035 GACTCTCCTGGCCAGGGGTAAGG - Intergenic
948359770 2:237412041-237412063 GCTTCTCTCGACCATGAGTGAGG + Intronic
948462601 2:238137593-238137615 GCATCTCAGGACCAGGAGTGGGG + Intergenic
948619370 2:239224482-239224504 TCTTCTCCTGACCAGGTCTTCGG + Intronic
949035543 2:241814297-241814319 GCTGCTCCAGATCTGGGGTGAGG + Intronic
1169184275 20:3600628-3600650 GCATCTCCTGACCTGTGCTGGGG - Intronic
1169769603 20:9186668-9186690 TCTTCTCCTTTCCAGTGGTGTGG + Intronic
1170591012 20:17771856-17771878 GCTTCTCCTGGGGAGGGGAGCGG - Intergenic
1170801289 20:19592614-19592636 ACCTCTCGTGGCCAGGGGTGAGG + Intronic
1171101665 20:22389401-22389423 GGTTATCTGGACCAGGGGTGGGG + Intergenic
1171869689 20:30515087-30515109 GCAGCTCCTCACCAGGGATGTGG - Intergenic
1171870476 20:30520865-30520887 GCAGCTCCTCACCAGGGATGTGG - Intergenic
1173189191 20:40863249-40863271 GCCTGTCCTGACCAGGGCAGGGG - Intergenic
1174725938 20:52862227-52862249 GCAGCTCCTGGACAGGGGTGGGG - Intergenic
1175410833 20:58767588-58767610 GCTTTTCATGACCTTGGGTGGGG - Intergenic
1176141276 20:63546198-63546220 GCTTGTCCTGAGCAGTGGTTGGG - Intronic
1176611911 21:8991270-8991292 GCAGCTCCTCACCAGGGATGTGG + Intergenic
1177167780 21:17622277-17622299 GCTCCTCCTGGGCTGGGGTGGGG - Intergenic
1180352539 22:11816610-11816632 GCAGCTCCTCACCAGGGATGTGG - Intergenic
1180353012 22:11819234-11819256 GCAGCTCCTCACCAGGGATGTGG + Intergenic
1180385233 22:12173123-12173145 GCAGCTCCTCACCAGGGATGTGG - Intergenic
1180385716 22:12175747-12175769 GCAGCTCCTCACCAGGGATGTGG + Intergenic
1181068256 22:20316656-20316678 GCCTCTGCCTACCAGGGGTGTGG + Intronic
1182918693 22:34059639-34059661 GCTGCTGCTCAGCAGGGGTGAGG + Intergenic
1183192004 22:36327625-36327647 GCTCCTCCTAGCCAGGTGTGAGG - Intronic
1184332116 22:43833760-43833782 GCTTCTCCTGCCCAGCCGTGTGG - Intronic
1184867436 22:47209475-47209497 GCCTCTCCTGCCCAGGGCAGAGG - Intergenic
1184914031 22:47555051-47555073 ACTTCTGAAGACCAGGGGTGAGG - Intergenic
1185383927 22:50523001-50523023 GCTGCTCCTGCACAGGGGAGGGG - Exonic
950028366 3:9835575-9835597 GCATCTCCGATCCAGGGGTGGGG + Intronic
950263966 3:11561393-11561415 GCATCTCCTGACCTGAGCTGGGG + Intronic
950637139 3:14323333-14323355 GCTTCTCCAGGCCTGGGGGGTGG - Intergenic
950665585 3:14493046-14493068 GCTTCTCCAGAATAGGGGTTTGG - Exonic
951892674 3:27581731-27581753 GATTCTCCTGACCAGGGAAGAGG - Intergenic
954364094 3:50137225-50137247 GCTTCCCCTGCCCAGATGTGAGG - Intergenic
954580842 3:51702255-51702277 GTTTCTTCTGACCAGGGGACAGG - Intronic
954698790 3:52441173-52441195 CCTACTGCTGGCCAGGGGTGGGG + Intronic
955699594 3:61670894-61670916 GCTTGCCCTGACTTGGGGTGGGG + Intronic
956406424 3:68932681-68932703 GCGCCGCCTGAGCAGGGGTGCGG - Intergenic
964533628 3:157695536-157695558 ACTTTTCCTGACAAGTGGTGGGG + Intergenic
967907384 3:194512958-194512980 GCATCACCTGCCCAGGTGTGTGG - Intergenic
968092396 3:195907507-195907529 GCTTCCCCTGCCCCTGGGTGGGG - Intronic
969471147 4:7389981-7390003 GCTTCTGCAGGCCTGGGGTGGGG + Intronic
969479673 4:7441275-7441297 GCTGCCCCTCACCTGGGGTGCGG - Intronic
969526528 4:7706675-7706697 GCTCCTCCTGGGCAGGGATGAGG + Intronic
970441408 4:16083607-16083629 GCATCTGCTGACCAGGCGCGGGG - Intronic
970547434 4:17144227-17144249 GCATCTCCTGGAGAGGGGTGGGG - Intergenic
972775569 4:42236765-42236787 GCTAGGCCTGACCAGGTGTGAGG + Intergenic
973375081 4:49280924-49280946 GCAGCTCCTCACCAGGGATGTGG - Intergenic
973375982 4:49286946-49286968 GCAGCTCCTCACCAGGGATGTGG - Intergenic
973376905 4:49293109-49293131 GCAGCTCCTCACCAGGGATGTGG - Intergenic
973377827 4:49299264-49299286 GCAGCTCCTCACCAGGGATGTGG - Intergenic
973378771 4:49305544-49305566 GCAACTCCTCACCAGGGATGTGG - Intergenic
973379447 4:49310110-49310132 GCAACTCCTCACCAGGGATGTGG + Intergenic
973381245 4:49322272-49322294 GCAGCTCCTCACCAGGGATGTGG + Intergenic
973382330 4:49329317-49329339 GCAGCTCCTCACCAGGGATGTGG + Intergenic
973385868 4:49513929-49513951 GCAGCTCCTCACCAGGGATGTGG + Intergenic
976497430 4:85746597-85746619 GCCTCTCCTGTTCAGGCGTGTGG - Intronic
977335235 4:95689604-95689626 GCTTCTCCTGTGCAGTGGGGAGG - Intergenic
977415085 4:96722277-96722299 GCTTCCCTTGGCCAGGGGTGGGG + Intergenic
978833105 4:113113311-113113333 GCTTCTCCTGGGCAGGGCTAGGG + Intronic
979268621 4:118732774-118732796 GCTGGTCATGACCATGGGTGTGG - Exonic
981644672 4:146985490-146985512 TCCTCTCCTTACCAGGGGTCTGG + Intergenic
982478191 4:155878094-155878116 GCTTCTCCTGTTCCTGGGTGGGG - Intronic
984295890 4:177854078-177854100 GCCTCTTCTGGCCAGTGGTGTGG - Intronic
984945926 4:184968859-184968881 GCCTGCCCTGCCCAGGGGTGTGG - Intergenic
985998393 5:3610760-3610782 GCTTCTGCTCACCAAGGGAGGGG + Intergenic
988617768 5:32792321-32792343 GATTCTGCTGACTCGGGGTGGGG + Intergenic
994844881 5:104975836-104975858 CCTTCGCCTTCCCAGGGGTGCGG + Intergenic
996789144 5:127273271-127273293 GCTTCCCTTGGCCAGGGGTGGGG + Intergenic
997838101 5:137212939-137212961 GCTGCTGCTGACCAGGGGGCAGG + Intronic
999202606 5:149826825-149826847 GCTTCTCCGGGGCAGGGCTGGGG - Exonic
999253716 5:150197421-150197443 TCTTCACCTGACCAGCTGTGTGG + Intronic
999871245 5:155753607-155753629 CCTTATTCTGACCAGGAGTGGGG + Intergenic
1000062340 5:157668679-157668701 GCTTTTCCTGATCAGTGATGGGG + Intronic
1001959357 5:175871175-175871197 GCTGCTCCTGAGGAGTGGTGGGG - Intronic
1002617599 5:180465350-180465372 GCTACTACTGGCCAGGGGTGGGG - Intergenic
1003025993 6:2556364-2556386 GCTGCTCCTTACCACGGTTGGGG - Intergenic
1004975226 6:20958051-20958073 GCCTCTTCTGGCCAGGGGTTAGG - Intronic
1006828527 6:36954721-36954743 CCTTCTCCCGTCCAGGGGTCTGG - Exonic
1006989360 6:38200023-38200045 GCTTCTCCTGACCTCAGGTCTGG - Intronic
1007269307 6:40624099-40624121 GATACTCCTGGGCAGGGGTGTGG - Intergenic
1010337166 6:74700170-74700192 TCTACTTCTTACCAGGGGTGTGG - Intergenic
1010714159 6:79208806-79208828 GCTTCTCCCAACTAAGGGTGTGG + Intronic
1018964655 6:168475210-168475232 GCTTCTCCAAAGCAAGGGTGAGG - Intronic
1018969567 6:168517239-168517261 GCTTCTGCAGAGCTGGGGTGGGG + Intronic
1019194561 6:170273490-170273512 GCTCCTCCTGAACTGGGGGGGGG + Intergenic
1019204636 6:170349923-170349945 GCTTCCCCTGGCTGGGGGTGGGG - Intronic
1020134489 7:5579401-5579423 GCTGCTCCTGGCCACGTGTGTGG - Intergenic
1024059632 7:45688105-45688127 GCTACTGCTGACCAGGGTTTCGG - Intronic
1025827810 7:65024828-65024850 GCATCTCCTGAACAGGGAGGTGG + Intergenic
1027045926 7:74991435-74991457 GCTGCTCCTGGCCTGGGGTGGGG - Intronic
1028504354 7:91555229-91555251 GCTTTTAGTGACCAGGAGTGGGG - Intergenic
1029386895 7:100249136-100249158 GCCGCTCCTGGCCTGGGGTGGGG + Intronic
1030418165 7:109271686-109271708 GCTGCTCCTGACCACAGCTGAGG + Intergenic
1030873924 7:114790245-114790267 GATTCTCCTGCCCTTGGGTGAGG - Intergenic
1032054758 7:128675353-128675375 GCTTCTCCTGCCCAAAGATGGGG + Intronic
1033134732 7:138774997-138775019 ATTTCTCTTGCCCAGGGGTGCGG + Intronic
1036288039 8:7462114-7462136 GCTGGTCCTGCCCAGGGGTTTGG + Intronic
1036333437 8:7849414-7849436 GCTGGTCCTGCCCAGGGGTTTGG - Intronic
1036439844 8:8772479-8772501 GCTACTCCAACCCAGGGGTGAGG - Intergenic
1036782291 8:11658123-11658145 GCCTCTGCAGACCAGGGCTGGGG - Intergenic
1038455848 8:27671341-27671363 GCTTCTACTGAGGAGGGCTGTGG + Exonic
1038614515 8:29080405-29080427 GGTTGTCCTGACCAGGGGCCTGG + Intronic
1039680470 8:39730198-39730220 GCTGCTTCTGGCCAGGGCTGGGG - Intergenic
1041615197 8:59898898-59898920 GCTTCTCTTGGCTGGGGGTGGGG - Intergenic
1044117323 8:88350813-88350835 GCTTCCCTTGGCTAGGGGTGAGG + Intergenic
1047667098 8:127104120-127104142 GCTTCTCCTGTCCATGGGCATGG - Intergenic
1047728221 8:127703170-127703192 GCTTTTCCTGAGAAGTGGTGCGG - Intergenic
1049001521 8:139828276-139828298 GCTTGTCCTGAACTGGCGTGAGG + Intronic
1049339215 8:142102998-142103020 GCTTCTCCTGGCCAGCCTTGGGG + Intergenic
1049436051 8:142586771-142586793 GCATGTCCTGGCCAAGGGTGAGG + Intergenic
1049438516 8:142598679-142598701 CCGTCGCCTGGCCAGGGGTGCGG - Intergenic
1051823101 9:21191566-21191588 GCCTCTCCTGCCCAGGGAAGTGG + Intergenic
1051824927 9:21210103-21210125 GCCTCTCCTGCCCAGGGAAGTGG + Intronic
1053392558 9:37746201-37746223 GCTTTTCCTCGACAGGGGTGCGG - Exonic
1056766295 9:89446659-89446681 ACTTCCCCTCAGCAGGGGTGTGG + Intronic
1057587741 9:96344792-96344814 GCTTCTGATGATGAGGGGTGGGG - Intronic
1060200652 9:121650286-121650308 GCCTTCCCTGACCAGGGGGGAGG - Intronic
1060295525 9:122340583-122340605 GCCTCACCTGCCCAGGGATGTGG - Intergenic
1061441766 9:130609478-130609500 GCTCCTCCTGGCCACGGGGGAGG - Intronic
1062524775 9:136973749-136973771 GCTTCTCGAGGCCAGGGGTGTGG + Intergenic
1062549708 9:137080390-137080412 ACCTCTCCTAACCATGGGTGGGG - Intronic
1203699755 Un_GL000214v1:125471-125493 GCAGCTCCTCACCAGGGATGTGG - Intergenic
1203700654 Un_GL000214v1:131463-131485 GCAGCTCCTCACCAGGGATGTGG - Intergenic
1203479489 Un_GL000224v1:61-83 GCAGCTCCTCACCAGGGATGTGG - Intergenic
1203480455 Un_GL000224v1:6357-6379 GCAGCTCCTCACCAGGGATGTGG - Intergenic
1203481422 Un_GL000224v1:12685-12707 GCAGCTCCTCACCAGGGATGTGG - Intergenic
1203482386 Un_GL000224v1:18994-19016 GCAGCTCCTCACCAGGGATGTGG - Intergenic
1203548975 Un_KI270743v1:152858-152880 GCAGCTCCTCACCAGGGATGTGG - Intergenic
1203549475 Un_KI270743v1:155691-155713 GCAGCTCCTCACCAGGGATGTGG + Intergenic
1203550433 Un_KI270743v1:162003-162025 GCAGCTCCTCACCAGGGATGTGG + Intergenic
1203569094 Un_KI270744v1:115419-115441 GCAGCTCCTCACCAGGGATGTGG - Intergenic
1203570043 Un_KI270744v1:121708-121730 GCAGCTCCTCACCAGGGATGTGG - Intergenic
1195234077 X:102879698-102879720 GTTTCTCCTGGACAGGGATGAGG - Intergenic
1197051109 X:122060941-122060963 GCTTCTCTTGGCTAGGGGAGAGG - Intergenic