ID: 1153019160

View in Genome Browser
Species Human (GRCh38)
Location 18:611155-611177
Sequence GAGCTGTAATAGGTGGCACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 99}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153019160_1153019165 5 Left 1153019160 18:611155-611177 CCCTGTGCCACCTATTACAGCTC 0: 1
1: 0
2: 0
3: 16
4: 99
Right 1153019165 18:611183-611205 CACCTTTGCATCTTTCAGAAAGG 0: 1
1: 0
2: 1
3: 20
4: 208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153019160 Original CRISPR GAGCTGTAATAGGTGGCACA GGG (reversed) Intronic
900791680 1:4684857-4684879 GAGCTGTCAAAGGGGCCACAAGG + Intronic
901296487 1:8165083-8165105 GAGCTGCATGGGGTGGCACATGG - Intergenic
905799307 1:40833146-40833168 GAGCAGCAGTGGGTGGCACACGG - Intronic
906780688 1:48570383-48570405 GGGCTGTGAGAGGTGGGACAGGG + Intronic
906838060 1:49105399-49105421 CAGCTGTAACAGGTGGGGCATGG - Intronic
907941351 1:59090780-59090802 GAACTTTAATAGGTGGCTTAGGG + Intergenic
908146214 1:61247510-61247532 GAGCTGTAACACCTGTCACAAGG - Intronic
908179273 1:61588069-61588091 GAGGTTTAATAGGTAGAACAAGG + Intergenic
909002412 1:70234414-70234436 GTGTTGTAATGGGTGGAACATGG + Intronic
910984523 1:92992639-92992661 CAACTGTAATAGGTGACACGAGG + Intergenic
912267041 1:108167992-108168014 CAGCTGTAAGAGGTGGCCCAAGG - Intronic
915450832 1:156003796-156003818 GAGGCTAAATAGGTGGCACAAGG - Intronic
920511456 1:206555460-206555482 GAGCTGTTATTGATGGCCCAAGG + Intronic
923455707 1:234163353-234163375 GTCATGTGATAGGTGGCACAGGG + Intronic
1064267450 10:13836546-13836568 GAGCTGGAATAGGTCTCACATGG + Intronic
1066641963 10:37562972-37562994 GAAGTGTAAGATGTGGCACAAGG - Intergenic
1070163366 10:73879731-73879753 GAGCTGTCATCAGAGGCACAAGG + Intergenic
1070737624 10:78875113-78875135 GAGCTGTAAGATGTGACACTTGG - Intergenic
1071180020 10:82973056-82973078 GCGCTGGAACAGGTGGCAAAAGG - Intronic
1077357327 11:2124490-2124512 GAGCTGTAATGGGGGGCAGATGG - Intergenic
1081377479 11:42377063-42377085 AAGCTGTAACAGGTGGCACCTGG + Intergenic
1081948969 11:47026178-47026200 GAGATGTAATATGTAGCAGAAGG + Intronic
1083924701 11:65798814-65798836 GAGCTCTTCTGGGTGGCACAGGG - Intergenic
1084889742 11:72230806-72230828 GAGCTGCAACAGCTGGCAGAAGG - Exonic
1085569981 11:77550808-77550830 GAGCTGGAATTGGAAGCACAGGG - Intronic
1088603974 11:111511825-111511847 GAGCTGTAATAGGTCAAAGAAGG - Intronic
1091252231 11:134153672-134153694 GAGGTGTAGTAAGTGGGACAGGG - Intronic
1093065609 12:14655078-14655100 GAGCTTTCATAGGTTGTACAAGG - Intronic
1093529220 12:20140995-20141017 GTGCTGTCATAGGCGTCACATGG + Intergenic
1095327479 12:40913321-40913343 AAGCTGTAATATGTGGAAGAAGG + Intronic
1099058757 12:77879096-77879118 CAGCTGTATTTGGTGGCATAGGG - Intronic
1100352368 12:93796818-93796840 GAGCTCTAATAGATAGCACAGGG - Intronic
1102474482 12:113179834-113179856 GAGATGTGACAGGTGGGACAAGG + Intronic
1105040961 12:132960940-132960962 GAGATGTAATAGGTGGTTCTTGG - Intergenic
1105992590 13:25637366-25637388 AAGCTGTAACAGATGGCACCTGG + Intronic
1110354510 13:74551822-74551844 TAGCTGTAATTATTGGCACATGG + Intergenic
1110722470 13:78779808-78779830 GGGCTGTCAGAGCTGGCACATGG - Intergenic
1112134661 13:96563639-96563661 AAGCTGTAATGGGTGATACAGGG + Intronic
1117343378 14:54810053-54810075 GAGCTGGAAGAGGTGGCCCAGGG + Intergenic
1118684766 14:68280437-68280459 GAGATCAAATAGCTGGCACATGG - Intronic
1119155768 14:72409302-72409324 GAGCTTTAATAGGCGGAACGTGG + Intronic
1121312528 14:92942955-92942977 GCACTGTAAGAGGTGGCACAGGG - Intronic
1125350485 15:38762010-38762032 GAGTTATAGTAGGTGGCAGATGG + Intergenic
1127881993 15:63166417-63166439 AAGATCCAATAGGTGGCACAAGG + Intergenic
1130329596 15:82911119-82911141 GAGCTGTCTAAGGTGGCAAAGGG - Intronic
1130790632 15:87152408-87152430 GAGCTGTAATTGGGGTCTCAAGG - Intergenic
1134063778 16:11213825-11213847 GGGCTGGAGTAGGTGGCCCACGG - Intergenic
1137051918 16:35721708-35721730 AAGCTGTGACAGATGGCACATGG - Intergenic
1138238027 16:55402048-55402070 ATGCTGTTATAGGTGGGACATGG + Intronic
1144328032 17:14200432-14200454 GGGCTGTATTAGGTGGGGCAAGG - Intronic
1153019160 18:611155-611177 GAGCTGTAATAGGTGGCACAGGG - Intronic
1153593484 18:6700046-6700068 AAGCTGTAACAGATGGCACCTGG + Intergenic
1153664815 18:7359439-7359461 GAGCAGTTATAGGTGACTCAAGG - Intergenic
1155126161 18:22878219-22878241 GTGATGTAATAGGAAGCACAAGG + Intronic
1157623688 18:49031189-49031211 GAGCTTTCACAGTTGGCACATGG + Intergenic
1163288932 19:16365902-16365924 AATCTGTAACAGGTGGCACCTGG - Intronic
1165216785 19:34280066-34280088 GAGCTTTTATTGGTGGCAGAAGG + Intronic
1165906914 19:39199955-39199977 GGGCTGGAATTGGAGGCACAGGG - Intronic
1168503803 19:56916034-56916056 TAGCTGTACTAGGTGGAACGGGG - Intergenic
926570101 2:14520288-14520310 GAGCTAGAAAAGGTGGCAGAAGG - Intergenic
932686006 2:73870812-73870834 GAGCTGTTCAACGTGGCACAGGG - Intronic
935303783 2:101717612-101717634 TAGCTTTAGTGGGTGGCACATGG + Intronic
935847132 2:107178006-107178028 GAGCTGAAATAGGAGAAACAGGG - Intergenic
941273076 2:163454811-163454833 GAGGTGTATTAGATGGCAAATGG - Intergenic
942393990 2:175526890-175526912 TGGCTGTACTAGGTGGTACAAGG - Intergenic
942408898 2:175685866-175685888 GTGCTGTGCTAGGTGGGACATGG - Intergenic
943965002 2:194321279-194321301 GGGCCTTAATAGGTGGCACCTGG + Intergenic
944253361 2:197599710-197599732 GAGGTGAAACATGTGGCACAGGG + Intronic
948472009 2:238188457-238188479 GAGCTCTAAGAGGTTGCACAGGG + Intronic
1170407064 20:16049652-16049674 GAACTGTAATTGCTGGCACATGG - Intronic
1170870445 20:20201253-20201275 GACTTGTAATAGTTTGCACATGG + Intronic
1173844109 20:46177276-46177298 CAGCTGTAACAGGTGGCATATGG + Intronic
1175146135 20:56897780-56897802 CAGCTGGCATAGGTGGCCCAGGG + Intergenic
1182832616 22:33315948-33315970 GAGCAGGAAGAGATGGCACATGG - Intronic
1184454981 22:44604845-44604867 GACATGTGATATGTGGCACATGG - Intergenic
950308952 3:11939291-11939313 GAGCTGTAAAGGGTGGCCCCTGG - Intergenic
954635599 3:52069156-52069178 GGGCTGCAATCGGTGGCCCAGGG - Intergenic
954670220 3:52287114-52287136 GAGCTGTATTTGGTGGCCCATGG + Intronic
954894838 3:53966331-53966353 CAGCAGTAATGGGTGGCACAGGG + Intergenic
957886678 3:86297278-86297300 AAGCTGTGACAGATGGCACATGG + Intergenic
961016686 3:123473900-123473922 GATCTGTAATAGCTGTTACAGGG + Intergenic
969880261 4:10167479-10167501 CAGCTCTAATAGTTGGCACTGGG + Intergenic
972722810 4:41717678-41717700 GAGCTGAAATAGGTCACCCAAGG + Intergenic
973542984 4:51953111-51953133 AAGCTGTGACAGATGGCACATGG - Intergenic
973934607 4:55830461-55830483 GAACTGTAATAGATGCCGCAGGG - Intergenic
974967131 4:68774099-68774121 AAGCTGTAACAGATGGCACCTGG - Intergenic
977843864 4:101743719-101743741 GAGCTGAAAAACATGGCACAAGG - Intronic
980447236 4:132926000-132926022 GAGATTTAAAAGGTGGCATAAGG - Intergenic
981943083 4:150307284-150307306 GACTTCTAGTAGGTGGCACAGGG + Intronic
982805569 4:159758652-159758674 GAGCTGGAATAAGTAGCACAAGG + Intergenic
984432367 4:179665199-179665221 GAGTAGTAACAGGTGGCACATGG - Intergenic
988425913 5:31064171-31064193 CATCTGCATTAGGTGGCACATGG - Intergenic
993768379 5:91892325-91892347 CAGCTCTCAAAGGTGGCACATGG + Intergenic
996453730 5:123656404-123656426 GAGCTGGAACAGCTGGGACACGG + Intergenic
997468176 5:134102046-134102068 CAGCTGTGATGGGAGGCACAGGG + Intergenic
997878686 5:137571036-137571058 GGGCTGTAGGAGGTGGCTCACGG + Intronic
1001175947 5:169469056-169469078 GTGCAGTAGTAGGTGGCACAGGG - Intergenic
1004624200 6:17359400-17359422 GAGGTATGATAGGTGGCCCAAGG + Intergenic
1006870716 6:37248730-37248752 GAGCAGAAATAGGTGGCAATGGG + Intronic
1011556743 6:88577341-88577363 GGACTGTAAAAGGTGGCACAGGG - Intergenic
1019824114 7:3269273-3269295 GAGCTGGAAGAGGTGGGACTGGG - Intergenic
1021209961 7:17837274-17837296 TAGCTGGAGTTGGTGGCACAAGG - Intronic
1024050381 7:45617413-45617435 CAGCTGTGATAGGTGGGACTGGG + Intronic
1024822693 7:53351971-53351993 AAGCTTTAATAGATGGGACACGG + Intergenic
1025614262 7:63104749-63104771 GAGTTGGAAGAGGTGGCCCAGGG - Intergenic
1029965508 7:104735600-104735622 AAGCTGTAACAGATGGCACCTGG - Intronic
1038134285 8:24768838-24768860 CAGCTGTCAGAGGTGGGACAGGG + Intergenic
1038716264 8:29993975-29993997 GAGATGGAAGAGGTGGCAGAGGG - Intergenic
1039703193 8:39981790-39981812 GAGATGGAAGAGGGGGCACAAGG + Intronic
1053215059 9:36264004-36264026 TAGCTGTGAGAGGTAGCACAGGG + Intronic
1057575259 9:96237379-96237401 GAGCTGCAACAGCTGGCCCATGG - Intronic
1058188135 9:101880007-101880029 GACCTATAATAAGTTGCACATGG + Intergenic
1192674857 X:73185092-73185114 AAGCTGTGATAGATGGCACCTGG + Intergenic
1194785912 X:98084134-98084156 GAGCTGTAATATTTGGAAGAGGG + Intergenic
1195826754 X:109010626-109010648 GAGCTGTGACAGATGGCACCAGG + Intergenic
1201568904 Y:15393508-15393530 CAGCTCTTAAAGGTGGCACATGG + Intergenic