ID: 1153022758

View in Genome Browser
Species Human (GRCh38)
Location 18:646334-646356
Sequence ATACAACTAGAAAAAAAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3934
Summary {0: 1, 1: 0, 2: 25, 3: 368, 4: 3540}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153022758_1153022761 25 Left 1153022758 18:646334-646356 CCTTTTTTTTTTTCTAGTTGTAT 0: 1
1: 0
2: 25
3: 368
4: 3540
Right 1153022761 18:646382-646404 GCATCTACTAAGTTTAGATACGG 0: 1
1: 0
2: 1
3: 5
4: 90
1153022758_1153022762 26 Left 1153022758 18:646334-646356 CCTTTTTTTTTTTCTAGTTGTAT 0: 1
1: 0
2: 25
3: 368
4: 3540
Right 1153022762 18:646383-646405 CATCTACTAAGTTTAGATACGGG 0: 1
1: 0
2: 0
3: 6
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153022758 Original CRISPR ATACAACTAGAAAAAAAAAA AGG (reversed) Intronic
Too many off-targets to display for this crispr