ID: 1153022759

View in Genome Browser
Species Human (GRCh38)
Location 18:646364-646386
Sequence GATGCTAAAAAGATATTGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 245
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 227}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153022759_1153022763 2 Left 1153022759 18:646364-646386 CCAACCAATATCTTTTTAGCATC 0: 1
1: 0
2: 0
3: 17
4: 227
Right 1153022763 18:646389-646411 CTAAGTTTAGATACGGGAACTGG 0: 1
1: 0
2: 0
3: 3
4: 31
1153022759_1153022762 -4 Left 1153022759 18:646364-646386 CCAACCAATATCTTTTTAGCATC 0: 1
1: 0
2: 0
3: 17
4: 227
Right 1153022762 18:646383-646405 CATCTACTAAGTTTAGATACGGG 0: 1
1: 0
2: 0
3: 6
4: 91
1153022759_1153022761 -5 Left 1153022759 18:646364-646386 CCAACCAATATCTTTTTAGCATC 0: 1
1: 0
2: 0
3: 17
4: 227
Right 1153022761 18:646382-646404 GCATCTACTAAGTTTAGATACGG 0: 1
1: 0
2: 1
3: 5
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153022759 Original CRISPR GATGCTAAAAAGATATTGGT TGG (reversed) Intronic
902711772 1:18245009-18245031 GACGCTATATAAATATTGGTAGG + Intronic
905894303 1:41535181-41535203 GATGCTAACAAAACCTTGGTCGG - Intronic
905943954 1:41886027-41886049 GATTCTAAGAATATATTGCTAGG - Intronic
907447567 1:54518733-54518755 GATACTCAAAAAATATTTGTTGG - Intergenic
907847906 1:58226230-58226252 GATGCTATACAAATATTGGTTGG + Intronic
908244047 1:62213578-62213600 GTTGCTGCAGAGATATTGGTGGG + Intergenic
908287506 1:62623478-62623500 AATGCTCAAAAAATACTGGTTGG + Intronic
909601102 1:77462278-77462300 GATGCTTAACAAATATTTGTTGG + Intronic
910864189 1:91772798-91772820 GATGCTAATATTGTATTGGTAGG - Intronic
911109789 1:94170655-94170677 AATGCAAAAAATATTTTGGTTGG + Intronic
912593057 1:110846864-110846886 GATGCTAAAAAGATTTTAAATGG - Intergenic
920820708 1:209378188-209378210 GATGAAAAAAAAATATTGATGGG + Intergenic
921224082 1:212999308-212999330 GATATAAAAAAGATATTGGCTGG - Intronic
921272546 1:213485442-213485464 AATGCTGAAAGGATATTGATGGG + Intergenic
921371269 1:214425099-214425121 GGTGCTAAATAGAGATTGATGGG - Intronic
921696777 1:218220468-218220490 GATGCTCAATAAATATTAGTTGG + Intergenic
923584560 1:235256206-235256228 GATGGTACAAAAATATTGATCGG - Intronic
924855505 1:247871180-247871202 AATGCTAAAAATAAATTGCTTGG + Intronic
1065262576 10:23939240-23939262 GATTTTAAAAATATATTGTTGGG - Intronic
1065935684 10:30518543-30518565 GCTGTGAAAAAGATATTTGTTGG - Intergenic
1066027675 10:31380072-31380094 AATGCTATACAGATCTTGGTTGG - Intronic
1066031708 10:31433834-31433856 GATGATACAAAGACAATGGTAGG - Intronic
1072008555 10:91282791-91282813 TATACTAATAAGATATTGGTTGG + Exonic
1074069811 10:110055172-110055194 GATGATAAAAACATATGGGCAGG + Intronic
1074247723 10:111711949-111711971 GATACTAGATAAATATTGGTTGG - Intergenic
1077746361 11:4911043-4911065 GGTACTCAATAGATATTGGTTGG + Intronic
1079131235 11:17748008-17748030 GATGCTCAATAAATATTTGTTGG - Intronic
1079464927 11:20720814-20720836 GAAGCTAAAATGAGGTTGGTAGG - Intronic
1080262666 11:30366346-30366368 GAGGCTAGAAAGAACTTGGTGGG + Intergenic
1082016098 11:47488953-47488975 GATGCTATCAAGATGTTTGTGGG - Exonic
1085793204 11:79514045-79514067 AATGCCCAAAAGATATTGGAAGG - Intergenic
1086209099 11:84296838-84296860 GTTGCTAAAAAGAATTTGGGGGG - Intronic
1086499015 11:87433253-87433275 GATGCTTAAATGATAATGGGAGG - Intergenic
1087265034 11:96051184-96051206 GATTCTAAATAAATATTGGACGG - Intronic
1087945365 11:104153802-104153824 GAAGCTAAAAATATATTTTTGGG + Intronic
1088628720 11:111753219-111753241 GATGATAAACAGATATTTCTAGG + Intronic
1090193815 11:124798883-124798905 GCTGCTAAAAAGATTGTGATAGG - Intronic
1094779243 12:33771765-33771787 GTTGATAAAAAGATTTTGATTGG + Intergenic
1096402791 12:51321267-51321289 AAGGCTCAAAAGAGATTGGTAGG - Intronic
1096983875 12:55744023-55744045 TATGCTAAAAAGATCCTTGTTGG + Intronic
1097436574 12:59557284-59557306 TATACTAAAAAGCTATTGGGAGG - Intergenic
1097574418 12:61373446-61373468 GATGCAGAAAAAATATTAGTTGG + Intergenic
1099155205 12:79166750-79166772 GATGCTATACAAATGTTGGTTGG + Intronic
1099402826 12:82221138-82221160 GTGGTTAAAAACATATTGGTTGG + Intergenic
1100190806 12:92189582-92189604 GATGCAAAAAAGACACTGGGAGG - Intergenic
1102794233 12:115674542-115674564 GATGCTTGAAAAATATTTGTTGG + Intergenic
1103681509 12:122697710-122697732 GATGCTGGAAAGAGATTGTTGGG + Intergenic
1103683241 12:122711141-122711163 GATGCTGGAAAGAGATTGTTGGG + Intergenic
1106297159 13:28425501-28425523 GATGCTAATAAAATATGGTTTGG - Intronic
1106473864 13:30080752-30080774 GTTGCAAACAAGATATTGGCTGG + Intergenic
1106482781 13:30149300-30149322 GATGCTCAATAAATATAGGTTGG - Intergenic
1107704707 13:43089910-43089932 GATGGTGTAAAAATATTGGTGGG + Intronic
1107945587 13:45415354-45415376 GCTGTTAAAAAAATATTGGTGGG + Intronic
1111926898 13:94473044-94473066 GATGCTAAATAAATGTTGCTTGG + Intronic
1111958799 13:94786555-94786577 GATGCTCAAAAAAAGTTGGTTGG + Intergenic
1112103902 13:96219449-96219471 GATGATAAAACTATATTGGAAGG - Intronic
1116215641 14:42013792-42013814 GCTACTTAAAAGATATTTGTTGG + Intergenic
1116219290 14:42061864-42061886 GAAGAAAAAAAGAGATTGGTGGG + Intergenic
1116454518 14:45103897-45103919 GATGGAAAAAAAATATTTGTAGG + Intronic
1117100688 14:52343362-52343384 GAAGCTAAAAATATCTTGGAAGG - Intergenic
1118980552 14:70712924-70712946 GATGCTCAATAAATATTTGTAGG + Intergenic
1119973508 14:78999413-78999435 GATACTCAAAATATATTTGTTGG + Intronic
1120929014 14:89828568-89828590 CATGCTAAAAACATAGTGTTCGG + Intronic
1121975315 14:98398169-98398191 GATGCTTAATAAATATTTGTGGG + Intergenic
1122016590 14:98802038-98802060 GATGCTAAAGGCATATTGGTAGG - Intergenic
1124084967 15:26540347-26540369 GATGCTAGTAAAATTTTGGTGGG + Intergenic
1124638359 15:31379423-31379445 GATGCTTAAAAAATATTGACAGG + Intronic
1126672136 15:51126170-51126192 AATGCTAATAATATGTTGGTTGG + Intergenic
1126993687 15:54414781-54414803 AATGTTAAAAAGTTATTGGATGG - Intronic
1128088528 15:64903091-64903113 GCTGTTAAAAAGAAATTAGTGGG - Intronic
1128386469 15:67152729-67152751 GATGCTACAAAGATCTGGGTTGG - Intronic
1132045115 15:98557250-98557272 GATGCTCAAAAAATATGTGTGGG - Intergenic
1132769462 16:1553116-1553138 GATGATGAAAAGATAATGCTTGG + Intronic
1133399019 16:5471206-5471228 GATGCTAAAAAGTTCTTAGTCGG + Intergenic
1137241584 16:46659273-46659295 GTTGCAAACAAGATACTGGTTGG - Exonic
1137897746 16:52232529-52232551 GATGCTAGAATGATATAGTTAGG - Intergenic
1138749853 16:59406603-59406625 GCTGTTAAAAAAATATTTGTTGG + Intergenic
1138936400 16:61730317-61730339 GTTCCTAAAAAGATATTAGTTGG - Intronic
1143859378 17:9877172-9877194 GATGCTCAATAAATATTTGTTGG + Intronic
1147173894 17:38639482-38639504 GATGTTAAAAAGATAATAGCAGG + Intergenic
1150461142 17:65354383-65354405 CATGGTCAAAAGATATTAGTGGG + Intergenic
1153022759 18:646364-646386 GATGCTAAAAAGATATTGGTTGG - Intronic
1153684799 18:7535190-7535212 TAGACTTAAAAGATATTGGTAGG - Intergenic
1158060544 18:53335361-53335383 GGTACTAAAAATATAGTGGTGGG - Intronic
1159094603 18:63887987-63888009 AATGCTACAAAGGTATTTGTTGG - Intronic
1160207718 18:76849290-76849312 AATTCTAAATACATATTGGTGGG - Intronic
1162754629 19:12850098-12850120 GGTGCTTAATAAATATTGGTGGG - Intronic
1166642100 19:44501818-44501840 GATGCTCAATAAATATTCGTTGG + Intronic
1167081461 19:47278923-47278945 GATGCTCAAAAAATAATTGTGGG - Intergenic
1168419028 19:56188831-56188853 GCTGCTAAAAAAATATTAGAAGG - Intergenic
928158714 2:28901155-28901177 TATGCTAAAAACATATAGGCTGG + Intronic
928258513 2:29745815-29745837 GGTGCTAAATAAATATTTGTTGG + Intronic
929196084 2:39186067-39186089 GATGCCTGAAAGATAATGGTGGG + Intronic
929217545 2:39431604-39431626 CAAGCCAAACAGATATTGGTGGG + Intronic
930571687 2:53094193-53094215 GATGCTAAAATAATCATGGTGGG - Intergenic
930900487 2:56501039-56501061 GGTGCTAAACAGATATTTGATGG - Intergenic
931098153 2:58965484-58965506 GATTCTAAAAAATTATTGGGAGG + Intergenic
932121624 2:69106050-69106072 TATGCTCTAAAGATATAGGTAGG + Intronic
932909070 2:75786540-75786562 GATGCTCAAAATATATTATTAGG + Intergenic
933337524 2:80977687-80977709 GATGCTAATAAGATATGAGGAGG - Intergenic
933470188 2:82712585-82712607 GACCCTATAAAAATATTGGTAGG - Intergenic
933911392 2:86943712-86943734 GATGTTAAAAGGATATTGGCGGG + Intronic
933947849 2:87302456-87302478 GATGCACAAAAGAAAATGGTAGG + Intergenic
935514294 2:104017494-104017516 TATACTAAAAATATATTCGTTGG - Intergenic
935991262 2:108720747-108720769 GATGTTAAAAGGATATTGGCGGG + Intronic
936332349 2:111559116-111559138 GATGCACAAAAGAAAATGGTAGG - Intergenic
936427160 2:112431934-112431956 GATGTTAAAAGGATATTGGCCGG - Intronic
938475490 2:131607531-131607553 AATGCTAAAAAGATTCTGATTGG - Intergenic
939013607 2:136875933-136875955 GAAGCTAAAAAGAGATTGAAAGG - Intronic
939512909 2:143128567-143128589 CATGCCAAAATGATATTGTTTGG + Intronic
940651953 2:156449472-156449494 AATGCTAAGAAGATTTTGTTGGG + Intronic
941144100 2:161821800-161821822 GATGTTAAAAATATGTTAGTAGG + Intronic
942485147 2:176431104-176431126 TATGCTGAAAAAATATTGGAAGG + Intergenic
942735108 2:179101342-179101364 TATCCTAAAAATATATTGGTAGG + Intergenic
944230643 2:197388711-197388733 GATTCTAAAAAGATTTTGAAAGG - Intergenic
946054712 2:216890652-216890674 GATGATAAAAAGCTAATGGCTGG - Intergenic
1169796748 20:9470532-9470554 GATGGTAAAAAGCTATTAATTGG - Intronic
1170236961 20:14117475-14117497 TATGCTCAAAGTATATTGGTAGG + Intronic
1170495547 20:16920716-16920738 AATGTTAAATAGATATTAGTAGG + Intergenic
1171469357 20:25357445-25357467 GATGCTCAAGAAGTATTGGTGGG + Intronic
1172214128 20:33222923-33222945 GATGCTCAATAAATATTTGTTGG + Intronic
1173239400 20:41280522-41280544 AATACTAAAAAGTTATTAGTGGG + Intronic
1173317792 20:41960688-41960710 GAAGCTCAACAGATATTTGTGGG + Intergenic
1177400335 21:20595170-20595192 GTAGCTAAAAAGATAAGGGTTGG + Intergenic
1177400340 21:20595211-20595233 GTAGCTAAAAAGATAAGGGTTGG + Intergenic
1178319497 21:31594623-31594645 GAAGCTTAAAAGCTAGTGGTGGG + Intergenic
1182951347 22:34379090-34379112 GATGCTTAACAAATATTTGTTGG - Intergenic
1184954675 22:47877947-47877969 GAGGCTCAATAGATATTTGTTGG + Intergenic
949202821 3:1400177-1400199 GATGCCAAAAACATCTTGTTGGG + Intronic
950087670 3:10272048-10272070 TATGCTCAAAAAATATTGGGAGG - Intronic
950198232 3:11024749-11024771 GAAGCTTAAAAGAGAATGGTAGG + Intronic
950255317 3:11499932-11499954 GATGCTCATAAAATATTTGTTGG - Intronic
950790431 3:15467206-15467228 GATGCTAGAAACACAATGGTAGG + Intronic
951431614 3:22614598-22614620 GAGGCCAAAAAGAAATTGATGGG - Intergenic
953002179 3:38946015-38946037 AATGAGAAAAAGATATGGGTTGG - Intronic
953224149 3:41001007-41001029 CATGCAAAAAATATTTTGGTCGG - Intergenic
955106245 3:55901356-55901378 GTTGCTATCAAGATATTGGCAGG + Intronic
955722787 3:61901364-61901386 GATGCAAAAAAGTTACTGGATGG + Intronic
957350953 3:79021159-79021181 ACTGCTGAAAAGATTTTGGTTGG - Intronic
957438873 3:80216544-80216566 ACTGCGAAAAAGATATTTGTTGG + Intergenic
959967307 3:112371591-112371613 GATGCTCAATAAATATTAGTTGG - Intergenic
963519642 3:146347781-146347803 CATGGAAAATAGATATTGGTGGG + Intergenic
963561221 3:146867983-146868005 GAAGCCAAAAAGAAAATGGTTGG + Intergenic
965512774 3:169587148-169587170 GATGCTCAATAAATATTGGTTGG - Intronic
967789372 3:193530864-193530886 GAGGCTGAAAAGATATTGTAGGG - Intronic
969642173 4:8405441-8405463 GCTGCTAAATAGATATATGTGGG + Intronic
969923983 4:10568406-10568428 GATGATAAAAATATATTGATTGG + Intronic
970379637 4:15493788-15493810 GATGCTCAAAGAATATTTGTTGG + Intronic
972218392 4:36923268-36923290 GATGCTGACAGGATACTGGTTGG + Intergenic
973248250 4:48033835-48033857 GAAGCTAAAAAGAATTTAGTAGG - Intronic
973930067 4:55783159-55783181 GTTGTCAAAAAGATACTGGTAGG - Intergenic
974646935 4:64706306-64706328 GATCCTAAAAGGAAATTGTTGGG + Intergenic
975162678 4:71141757-71141779 TATGCTTAAAAAATATTGGATGG + Intergenic
976196665 4:82538757-82538779 GATGTTAAAAAGACATTTGAGGG + Intronic
976200159 4:82570078-82570100 GATGATAAAAAGATACTTTTTGG - Intergenic
976864868 4:89712320-89712342 GAAGCTAAAATAATATTAGTGGG + Intergenic
978242321 4:106531027-106531049 TATCCTGAAAAGAAATTGGTAGG + Intergenic
978360244 4:107923925-107923947 GATTCTCAAAATACATTGGTAGG + Intergenic
978689876 4:111494827-111494849 GATGCTTAAAAAATACAGGTTGG + Intergenic
979519516 4:121650378-121650400 AACACTAAAAAGATTTTGGTGGG + Intergenic
980320705 4:131269775-131269797 GATTCTAAAAGAATATTGGCTGG + Intergenic
981686032 4:147456025-147456047 TATGCTGCTAAGATATTGGTGGG - Intergenic
981700008 4:147597936-147597958 GATGCAATAAAGATATTAGCTGG - Intergenic
984923980 4:184790480-184790502 GATGATTAAAAGATATGGTTAGG - Intronic
987450399 5:18076952-18076974 AATGCTTATAAAATATTGGTAGG + Intergenic
989019671 5:36988202-36988224 GGTGCTAAAAACATATTCATAGG - Intronic
989669536 5:43899281-43899303 GATGCTTAAGAAATACTGGTTGG + Intergenic
991711624 5:69414598-69414620 GATGCAAAAACGTTATTGGGGGG + Exonic
992375413 5:76183557-76183579 GTTGCTAAAATGATATTTGAAGG + Intronic
993600733 5:89921398-89921420 GGTGCTTAATAAATATTGGTTGG - Intergenic
994870672 5:105346413-105346435 GATATTAAAAATATCTTGGTAGG - Intergenic
994870822 5:105348543-105348565 GATATTAAAAATATCTTGGTAGG + Intergenic
995745936 5:115403377-115403399 GATGCCAAAAAGATGTTTCTTGG + Intergenic
996692464 5:126355177-126355199 GTTGCTCAATAGATATTTGTAGG - Intergenic
998318543 5:141207146-141207168 GATGGAAAAAAGTTATTAGTTGG - Intergenic
1000127783 5:158263666-158263688 GAGGTTAAAAGGAAATTGGTAGG + Intergenic
1000431606 5:161159207-161159229 GATGGGAAAAAGAGATTGATTGG - Intergenic
1000487963 5:161871660-161871682 GGTGCTTAAGAGATATTTGTTGG + Intronic
1000601575 5:163281659-163281681 AATGCTAAATAAATATTTGTTGG - Intergenic
1001853518 5:174990433-174990455 GATACTGAAAGGATATTAGTTGG + Intergenic
1003238387 6:4319008-4319030 GATGCTAAAAATATTCTTGTAGG + Intergenic
1003370638 6:5522582-5522604 GATAAAAATAAGATATTGGTTGG - Intronic
1008873476 6:56300939-56300961 GATGCTCAAAATATGTTTGTCGG - Intronic
1008929708 6:56925800-56925822 GATGCTAAAAATAGATTCATTGG - Intronic
1010453851 6:76032437-76032459 GATTTTAAAAAGATATTGCCAGG - Intronic
1011624122 6:89269763-89269785 GATGCTCAATAGATATTTGCTGG + Intronic
1011866873 6:91840137-91840159 GGTACTCAACAGATATTGGTTGG - Intergenic
1011913978 6:92479106-92479128 GACACTAAAAAGATAAAGGTTGG + Intergenic
1012554491 6:100495074-100495096 AATGCTAAAATGTTATTGATTGG - Intergenic
1012911746 6:105125760-105125782 GATGCTAAAAGGGTATGGTTAGG + Intronic
1012967515 6:105690611-105690633 GAGGATAAATAGATATTGATGGG + Intergenic
1013492647 6:110664096-110664118 CATGCTCAGAAGATATGGGTTGG - Intronic
1013781144 6:113729961-113729983 GGTGCTCAATAGATATTTGTTGG + Intergenic
1014615936 6:123599738-123599760 AATACTAAAAAGATTTTGGTAGG - Intronic
1015560415 6:134509348-134509370 GTTGGTAAAAAGGTAATGGTGGG - Intergenic
1016283142 6:142442361-142442383 AGTGCTTAAAAGATATTTGTAGG + Intronic
1017090470 6:150754559-150754581 GTTTCAAAAAAGATATAGGTGGG + Intronic
1020567817 7:9819663-9819685 CAAGCTAAAAGGATATTTGTCGG - Intergenic
1021475936 7:21060460-21060482 GGTGATAAAAGGATTTTGGTGGG - Intergenic
1021953768 7:25802968-25802990 CCTCCTAAAAAGATATTGGAAGG + Intergenic
1025018559 7:55462910-55462932 GAAGTTAAAAATATATTGGGAGG - Intronic
1027484845 7:78748691-78748713 GATGTAAAAAAGATATCGATAGG + Intronic
1027592315 7:80132972-80132994 AATGATAACAGGATATTGGTGGG - Intergenic
1029934145 7:104405702-104405724 GTTGCCAAGAAGATAATGGTTGG - Intronic
1032142235 7:129342370-129342392 GATTTTAAAAATATATGGGTAGG + Intronic
1033843952 7:145409449-145409471 GATGTTTAACAGATATTTGTTGG + Intergenic
1036447715 8:8837092-8837114 AATGCTAAATAAATATTTGTGGG - Intronic
1038103603 8:24408484-24408506 GATGCTATACAGATATGGGAAGG + Intergenic
1038149425 8:24929141-24929163 GATGTGAACAAGATATTGCTTGG + Intergenic
1038527431 8:28288393-28288415 GATTCTGGAAAGATGTTGGTTGG - Intergenic
1041134671 8:54744583-54744605 GATGGTAATAAAATATTTGTAGG - Intergenic
1043217657 8:77615065-77615087 GATGCCTAATAAATATTGGTTGG + Intergenic
1043247659 8:78025934-78025956 GATGCTTAATAGATTTTGTTTGG + Intergenic
1043260616 8:78190644-78190666 CATACTAAAAATCTATTGGTAGG + Intergenic
1044045652 8:87428356-87428378 GATGCTAAAATTTTATGGGTTGG + Intronic
1046113650 8:109758446-109758468 TATTCATAAAAGATATTGGTTGG + Intergenic
1047146808 8:122210052-122210074 GATTATAAAAAGATATTAGGTGG - Intergenic
1049227051 8:141459384-141459406 GCTGTGAAAAAGATATTTGTTGG + Intergenic
1050350094 9:4733202-4733224 GATGCTAAAAGCATTTTGGCAGG - Intronic
1051009401 9:12392918-12392940 GATGCCAAACAGATATTGTTGGG + Intergenic
1051034642 9:12728875-12728897 GATGCTAATAAAATATTGGGAGG - Intergenic
1051265943 9:15307969-15307991 GGTGCTCAACAGATATTTGTTGG + Intergenic
1051991453 9:23157388-23157410 GATGTTATAAAAATATTAGTTGG + Intergenic
1053236133 9:36455998-36456020 GATGCTAGAAAGAAATGGGAAGG - Intronic
1054930941 9:70634663-70634685 GATGGGAAAAAAATGTTGGTAGG - Intronic
1055449652 9:76419331-76419353 GTTACTAAATACATATTGGTTGG + Intergenic
1057488008 9:95501138-95501160 GATGATAAAAAGATTTTGATTGG - Intronic
1059088178 9:111327520-111327542 GATGCTATGAAGAAATTGCTGGG - Exonic
1060311662 9:122467941-122467963 GAAGGCAAGAAGATATTGGTTGG - Intergenic
1060791140 9:126486527-126486549 GATGCCAAATGGATATAGGTGGG + Intronic
1060824937 9:126682593-126682615 GACGCTAAAGAAATATTTGTGGG + Intronic
1186083155 X:5955112-5955134 AATGCTAAAATGATAATAGTAGG - Intronic
1186636421 X:11409859-11409881 GATGCTCAAAAGATTGAGGTTGG + Intronic
1187342356 X:18432540-18432562 GATGACAAAAAGATCTAGGTTGG - Intronic
1187535717 X:20140250-20140272 GATGCTTAATAAATATTTGTTGG - Intronic
1189195699 X:39150446-39150468 AATGCTAAAATGATTTTGGCAGG + Intergenic
1189390063 X:40569124-40569146 GATGCTGATAATATATTGTTGGG + Intergenic
1193946311 X:87740017-87740039 GTTTCTAGAAAGAAATTGGTGGG - Intergenic
1195284851 X:103374772-103374794 CATACTAAGAAGATATTTGTAGG + Intergenic
1196796436 X:119505652-119505674 GATGCTCAATAAATATTAGTTGG - Intergenic
1198875383 X:141219553-141219575 TATACTAAAGAGATATTAGTGGG - Intergenic
1199288895 X:146084103-146084125 TATGCTAAAAATGTATTTGTTGG - Intergenic
1201488980 Y:14521781-14521803 GATTCTAAAATGAGATTGCTTGG - Intergenic
1202350681 Y:23987137-23987159 GATGTTAAAAATATATGGGAAGG + Intergenic
1202520098 Y:25682983-25683005 GATGTTAAAAATATATGGGAAGG - Intergenic